On Algebraic Approaches for DNA Codes with Multiple Constraints

1 Introduction

DeoxyriboNucleic Acid (DNA) is a blue-print of life storing all the instructions for making living species. The basic structure of DNA is given in Fig. 1. It is a robust molecule and has been used in many emerging areas of DNA computing, DNA nanotechnology, DNA origami, Chemical computing and synthetic biology etc. In most of these applications it is required to construct a set of DNA strings (called DNA codes) that are sufficiently dissimilar. This results in a beautiful but tough problem of construction of DNA strings with certain thermodynamic and combinatorial constraints. There are many ways to construct these objects such as computational (algorithmic ways) and mathematical (algebraic and Combinatorial). This chapter will focus on algebraic ways to construct such DNA codes. The chapter is organised as follows.

DNA strings and their properties are discussed in Section 2. Section 3 describes various properties and constrains for DNA codes. Constructions of DNA codes with various properties and constraints are given in Section 4 using bijective maps. Then, DNA codes are constructed from binary codes using Non-Homopolymer Map in Section 5. Further, several algebraic bounds are listed in Section 6, and finally some open problems are given in Section 7.

t]

Figure 1: DeoxyriboNucleic Acid (DNA) is a double helix structure that is formed by phosphate group, sugar, and four nucleotides (also called bases): Adenine (A), Guanine (G), Cytosine (C), and Thymine (T). Adenine and Thymine bind to each other with double hydrogen bond, and similarly, Guanine and Cytosine bind with triple hydrogen bond. Thus, Adenine and Thymine, and also, Guanine and Cytosine are Watson-Crick complement to each other.

2 DNA Strings and its Properties

In this section, we have defined terms, notations, and properties of DNA strings those are used in this chapter.

2.1 DNA Strings

In this section, we have given formal definitions for string, reverse string, sub-string, concatenated string, DNA string, concatenated DNA string, DNA sub-string in Definition 1.

Definition 1

For the alphabet $\mathcal{A}_{q}$ of size $q$ and an integer $n$ ($\geq 1$), any one dimensional array ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})\in\mathcal{A}_{q}^{n}$ is called a string of length $n$. For any strings ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})$ over $\mathcal{A}_{q}$,

• the reverse string is ${\bf x}^{r}$ = $(x_{n}\ x_{n-1}\ \ldots\ x_{1})$,

• for given $1\leq i<j\leq n$, the sub-string is ${\bf x}(i,j)$ = $(x_{i}\ x_{i+1}\ \ldots\ x_{j})$,

• for given positive integers $i,j,k,l$ ($1\leq i<j\leq n$ and $1\leq k<l\leq n$), two sub-strings ${\bf x}(i,j)$ and ${\bf x}(k,l)$ are known as disjoint sub-strings of the string ${\bf x}$ if $j<k$.

• for string ${\bf y}$ = $(y_{1}\ y_{2}\ \ldots\ y_{m})$ of length $m$ over $\mathcal{A}_{q}$, the string

  $$({\bf x}\ {\bf y})=(x_{1}\ x_{2}\ \ldots\ x_{n}\ y_{1}\ y_{2}\ \ldots\ y_{m})$$

  of length $n+m$ is called the concatenated string of strings ${\bf x}$ and ${\bf y}$.

Example 1

Example For $q$ = $2$, consider the alphabet $\mathcal{A}_{2}$ = $\{0,1\}$.

• For the string ${\bf z}$ = $(1\ 0\ 0\ 0\ 1\ 1\ 1)$ of length $7$, the reverse string ${\bf z}^{r}$ = $(1\ 1\ 1\ 0\ 0\ 0\ 1)$.

• The string ${\bf z}(3,6)$ = $(0\ 0\ 1\ 1)$ is a sub-string of the string ${\bf z}$ = $(1\ 0\ 0\ 0\ 1\ 1\ 1)$.

• The sub-strings ${\bf z}(1,3)$ = $(1\ 0\ 0)$ and ${\bf z}(5,6)$ = $(1\ 1)$ are disjoint sub-strings of the string ${\bf z}$ = $(1\ 0\ 0\ 0\ 1\ 1\ 1)$.

• For ${\bf z}_{1}$ = $(1\ 1\ 1\ 1\ 0)$ and ${\bf z}_{2}$ = $(0\ 0\ 0\ 1)$, the string $({\bf z}_{1}\ {\bf z}_{2})$ = $(1\ 1\ 1\ 1\ 0\ 0\ 0\ 0\ 1)$ is the concatenated string of ${\bf z}_{1}$ and ${\bf z}_{2}$.

For any string ${\bf x}$ of length $n$ over the alphabet $\mathcal{A}_{q}$, the length of the reverse string ${\bf x}^{r}$ is also $n$. For any element $a$ in an alphabet $\mathcal{A}_{q}$ of size $q$, ${\bf a}_{r,s}$ is an array of $r$ rows and $s$ columns, $i.e.$,

$${\bf a}_{r,s}=\left(\begin{array}[]{cccc}a&a&\ldots&a\\ a&a&\ldots&a\\ \vdots&\vdots&\ddots&\vdots\\ a&a&\ldots&a\end{array}\right)_{r\times s}.$$

For the particular case $q$ = $2$, any string and their sub-strings defined over the alphabet $\mathcal{A}_{2}$ is called binary string and binary sub-strings, respectively. Now, we define DNA strings as given in Definition 2

Definition 2

A DNA string is a string defined over the quaternary alphabet $\Sigma_{DNA}$ = $\{A,C,G,T\}$. For simplicity, we represent DNA string of length $n$ as ${\bf x}$ = $x_{1}x_{2}\ldots x_{n}$. For two DNA strings ${\bf x}$ and ${\bf y}$, the concatenated DNA string of ${\bf x}$ and ${\bf y}$ is represented by xy. Similarly, for any DNA string ${\bf x}$ = $x_{1}x_{2}\ldots x_{n}$ of length $n$, a sub-string ${\bf x}(i,j)$ = $x_{i}x_{i+1}\ldots x_{j}$ is called DNA sub-string, where $1\leq i<j\leq n$.

Example 2

Example Again, the string $AACGAAT\in\Sigma_{DNA}^{7}$ is a DNA string of length $7$ bps. For DNA strings ${\bf x}$ = $CACAGT\in\Sigma_{DNA}^{6}$ and ${\bf y}$ = $AAACGCGGG\in\Sigma_{DNA}^{9}$, strings xy = $CACAGTAAACGCGGG$ and yx = $AAACGCGGGCACAGT$ are concatenated DNA strings each of length $9$ bps.

2.2 Basic Properties of DNA Strings

In this section, we have given formal definitions for reverse, reverse-complement and $GC$-weight of any given DNA string.

Definition 3

For any given DNA string ${\bf x}$ = $x_{1}x_{2}\ldots x_{n}$ of length $n$,

• the reverse DNA string is ${\bf x}^{r}$ = $x_{n}x_{n-1}\ldots x_{1}$ of length $n$,

• the Watson-Crick complement or simply complement DNA string is ${\bf x}^{c}$ = $x_{1}^{c}x_{2}^{c}\ldots x_{n}^{c}$ of length $n$, and

• the reverse-complement DNA string is ${\bf x}^{rc}$ = $x_{n}^{c}x_{n-1}^{c}\ldots x_{1}^{c}$ of length $n$,

where $A^{c}$ = $T$, $C^{c}$ = $G$, $G^{c}$ = $C$, and $T^{c}$ = $A$, $i.e.$, Watson-Crick complement of $A,C,G$ and $T$ are $T,G,C$ and $A$, respectively. for simplicity, we call the reverse DNA string and reverse-complement DNA string as R DNA string and RC DNA string, respectively. Further, the $GC$-weight of the DNA string ${\bf x}$ is the sum of the number of nucleotide $C$ and the number of nucleotide $G$ in the DNA string ${\bf x}$. We denote the $GC$-weight of the DNA string ${\bf x}$ by $w_{GC}({\bf x})$.

Example 3

Example For the DNA string ${\bf x}$ = $AAGCCAAATC$ of length $10$ bps,

• the reverse DNA string (or R DNA string) is ${\bf x}^{r}$ = $CTAAACCGAA$,

• the Watson-Crick complement or complement DNA string is ${\bf x}^{c}$ = $TTCGG$- $TTTAG$,

• the reverse-complement DNA string (or RC DNA string) is ${\bf x}^{rc}$ = $GATTTGGCTT$, and

• the $GC$-weight of the DNA string is $w_{GC}({\bf x})$ = $w_{GC}(AAGCCAAATC)$ = $4$.

For several molecular biology techniques, such as designing optimal DNA microarrays, quantitative PCR, and multiplex PCR, DNA hybridization is involved, and it depends on the experimental value of some parameters such as malting temperature Howley1979 ; MARMUR1962109 ; 10.1093/bioinformatics/bti066 ; RUSSELL1969473 . In MARMUR1962109 , the melting temperature of a DNA string ${\bf x}$ of length $n$ and $GC$-weight $w_{GC}({\bf x})$ is given by

$$T_{\bf x}=64.9+41.0\times\left(\frac{w_{GC}({\bf x})-16.4}{n}\right).$$ (1)

Further, in Howley1979 , the salt adjust melting temperature of a DNA string ${\bf x}$ of length $n$ and $GC$-weight $w_{GC}({\bf x})$ is

$$T_{\bf x}=100.5+41.0\times\left(\frac{w_{GC}({\bf x})-36.4}{n}\right)+16.6\log([Na^{+}]).$$ (2)

Hence, for given length $n$, DNA strings have similar melting temperature if they have similar $GC$-weight.

2.3 Secondary Structures of DNA strings

t]

Figure 2: Consider the DNA string ${\bf x}$ = $AAAAAAAAAAAAAAAAAATTTTTTTTTTTTT$- $TTTTTTTTCGCGTGCGCGCGCGCG$ of length $55$ bps. The DNA sub-strings ${\bf x}(6,16)$ and ${\bf x}(40,45)$ bind pairwise with ${\bf x}(25,35)^{r}$ and ${\bf x}(50,55)^{r}$, and it forms two stems one of length $11$ bps and another of length $6$ bps. The secondary structure for the DNA string ${\bf x}$ is predicted by The Vienna RNA Websuite 10.1093/nar/gkn188 ; Lorenz2011 .

Any chemically active DNA string ${\bf x}$ = $x_{1}x_{2}\ldots x_{n}$ of length $n$ form secondary structures by binding upon itself. An example of such secondary structure in a DNA string is given in Fig. 2. Secondary structures can be deduced in a physical DNA using mostly Nuclear Magnetic Resonance (NMR) and X-ray crystallography. Like all other molecules, DNA must follow the thermodynamic laws, and thus, it is an assumption that the natural fold in any DNA is law energy structure Deschnes2005AGA . In a given DNA string, secondary structures are approximately predicted using a dynamic algorithm known as the Nussinov-Jacobson folding algorithm (NJ algorithm) Nussinov6309 . When a DNA string forms a secondary structure then it releases energy called free energy, and thus, secondary structures can be predicted by computing the free energy Clote2000ComputationalMB . Further, the free energy can be calculated by computing energies released by binding of $x_{i}$ with $x_{j}$ for $i,j\in\{1,2,\ldots,n\}$ and $i<j$. The energy released by binding of $x_{i}$ and $x_{j}$ are known as interaction energy and it is denoted by $\alpha(x_{i},x_{j})$. The assumption for the NJ algorithm is following.

Assumption

In a DNA string ${\bf x}$ = $x_{1}x_{2}\ldots x_{n}$ of length $n$, the interaction energy $\alpha(x_{i},x_{j})$ between nucleotides $x_{i}$ and $x_{j}$ is not depend on all other nucleotide pairs for $1\leq i<j\leq n$.

The interaction energy $\alpha(x_{i},x_{j})$ is a non-positive value and it depends on the nucleotides $x_{i}$ and $x_{j}$. For any DNA string, the preferable value of interaction energy between $x_{i}$ and $x_{j}$ (for details please see Clote2000ComputationalMB ) is

$$\alpha(x_{i},x_{j})=\left\{\begin{array}[]{rl}-5&\mbox{ if }(x_{i},x_{j})\in\{(G,C),(C,G)\},\\ -4&\mbox{ if }(x_{i},x_{j})\in\{(T,A),(A,T)\},\\ -1&\mbox{ if }(x_{i},x_{j})\in\{(T,G),(G,T)\},\\ 0&\mbox{ otherwise.}\end{array}\right.$$ (3)

From the assumption, the minimum free energy, $E_{i,j}$, for the sub-string ${\bf x}(i,j)$ of DNA string ${\bf x}$ = $x_{1}x_{2}\ldots x_{n}$ is

$$E_{i,j}=\min\left\{E_{i+1,j-1}+\alpha(x_{i},x_{j}),\min_{i<k\leq j}(E_{i,k-1}+E_{k,j})\right\},$$ (4)

with the initial conditions $E_{r,r}$ = $0$ and $E_{r-1,r}=0$ for $r=i,i+1,\ldots,j$ Clote2000ComputationalMB ; 10.1007/11779360_9 . These initial conditions are followed from the fact that any nucleotide does not interact with itself and immediate neighbours for secondary structures in any DNA. For the DNA string ${\bf x}$ of length $n$, the minimum free energy is given by $E_{1,n}$. A low negative value of $E_{1,n}$ for any DNA string of length $n$ is a good indicator of secondary structures those are exist in the physical DNA. For any given DNA string, secondary structures are predicted by the RNAfold Web Server using the NJ algorithm 10.1093/nar/gkn188 . one can observe form the Equation (3), any DNA string avoids secondary structures if the DNA string avoids the pairing of $A$ and $T$, the pairing of $G$ and $C$, and the pairing of $G$ and $T$. Using the observation, DNA codes that avoids secondary structures are constructed in 9214530 .

From the definition of the interaction energy, we define two terms secondary-complement and reverse-secondary-complement DNA strings as given in Definition 4.

Definition 4

For any DNA string ${\bf x}=x_{1}x_{2}\ldots x_{n}$ of length $n$,

• the secondary-complement DNA string ${\bf x}^{s}=x_{1}^{s}x_{2}^{s}\ldots x_{n}^{s}$ of length $n$, and

• the reverse-secondary-complement DNA string ${\bf x}^{rs}=x_{n}^{s}x_{n-1}^{s}\ldots x_{1}^{s}$ of length $n$,

where $A^{s}=T$, $T^{s}=A$, $C^{s}=G$, $G^{s}=C$, $G^{s}=T$ and $T^{s}=G$.

Example 4

Example Consider the DNA string ${\bf x}$ = $ATGAA$ of length $5$ bps. Then

• all the DNA strings $TACTT$, $TGCTT$, $TATTT$ and $TGTTT$ are the secondary-complement DNA strings of ${\bf x}$, and

• all the DNA strings $TTCAT$, $TTCGT$, $TTTAT$ and $TTTGT$ are the reverse-secondary-complement DNA strings of ${\bf x}$.

Note that the secondary-complement and reverse-secondary-complement DNA strings of ${\bf x}$ are not unique.

Observe that the secondary-complement of $T$ and $G$ are not unique, and therefore, the secondary complement of any DNA string having the nucleotide $G$ and/or nucleotide $T$ is not unique. Also, for any DNA string ${\bf x}$,

• the DNA string ${\bf x}^{c}$ is a secondary-complement DNA string, and

• the DNA string ${\bf x}^{rc}$ is a reverse-secondary-complement DNA string.

Proposition 1

If the DNA string ${\bf x}$ of length $n$ forms a secondary structure with stem length $\ell$ then there exist two disjoint DNA sub-strings ${\bf x}(i,i+\ell-1)$ and ${\bf x}(j,j+\ell-1)$ ($i\geq j+\ell$) such that ${\bf x}(j,j+\ell-1)={\bf x}(i,i+\ell-1)^{s}$ or ${\bf x}(j,j+\ell-1)={\bf x}(i,i+\ell-1)^{rs}$.

Now, one can find the following remark.

Remark 1

Consider a DNA string ${\bf x}$ of length $n$ such that the DNA string does not have two sub-strings ${\bf x}(i,i+\ell-1)$ and ${\bf x}(j,j+\ell-1)$ ($i+\ell<j$) such that ${\bf x}(j,j+\ell-1)\neq{\bf x}(i,i+\ell-1)^{s}$ and ${\bf x}(j,j+\ell-1)\neq{\bf x}(i,i+\ell-1)^{rs}$. Then, the DNA string ${\bf x}$ does not form any secondary structure with stems of length $\ell$.

Now, as defined in Zuker1984 , the secondary structure for any DNA string is defined as following.

Definition 5

For any DNA string ${\bf x}=x_{1}x_{2}\ldots x_{n}$ of length $n$, consider a set $S$ = $\{{\bf x}(i_{1},i_{2})$, ${\bf x}(i_{3},i_{4})$, $\ldots$, ${\bf x}(i_{2j-1},i_{2j})\}$ of DNA sub-strings of ${\bf x}$ such that $1\leq i_{1}<i_{2}<i_{3}<\ldots<i_{2j}\leq n$. A secondary structure is the result of binding pairwise of the nucleotides of DNA sub-strings in the set $S$, $i.e.$, for each ${\bf x}(i_{s},i_{s+1})\in S$ there exist some ${\bf x}(i_{t},i_{t+1})\in S$ such that all the nucleotides of the sub-string ${\bf x}(i_{s},i_{s+1})$ bind pairwise to either the nucleotides of ${\bf x}(i_{t},i_{t+1})$ or the nucleotides of ${\bf x}(i_{t},i_{t+1})^{r}$, where the length of the sub-strings ${\bf x}(i_{s},i_{s+1})$ and ${\bf x}(i_{t},i_{t+1})$ are the same, $i.e.$, $i_{t+1}-i+1$ = $i_{s+1}-i_{s}+1$, and $s,t\in\{1,2,\ldots,2j-1\}$. Binding of ${\bf x}(i_{s},i_{s+1})$ to either ${\bf x}(i_{t},i_{t+1})$ or ${\bf x}(i_{t},i_{t+1})^{r}$ forms stem of length $i_{s+1}-i_{s}+1$ in the secondary structure for the DNA string ${\bf x}$. Note that every set of DNA sub-strings is not a valid secondary structure, as most possibilities are removed due to chemical and stereochemical constraints.

Example 5

Example As shown in Fig. 2, for the DNA string ${\bf x}$ = $AAAAAAAAAAAAAAAAAA$- $TTTTTTTTTTTTTTTTTTTTTCGCGTGCGCGCGCGCG$ of length $55$ bps, consider $S$ = $\{{\bf x}(6,16),$ ${\bf x}(25,35),{\bf x}(40,45),{\bf x}(50,55)\}$, where ${\bf x}(6,16)$ = $AAAAAA$- $AAAAA$, ${\bf x}(25,35)$ = $TTTTTTTTTTT$, ${\bf x}(40,45)$ = $CGCGTG$, and ${\bf x}(50,55)$ = $CGCGCG$. The DNA sub-strings ${\bf x}(6,16)$ of length $11$ bps and ${\bf x}(40,45)$ of length $6$ bps bind pairwise with ${\bf x}(25,35)^{r}$ of length $11$ bps and ${\bf x}(50,55)^{r}$ of length $6$ bps, respectively. Also, observe that ${\bf x}(6,16)$ = ${\bf x}(25,35)^{rs}$ and ${\bf x}(40,45)$ = ${\bf x}(50,55)^{rs}$. The secondary structure has two stems of length $11$ bps and $6$ bps.

In Definition 5, each set of sub-strings of any DNA string is not valid secondary structure, therefore, Proposition 1 is not true in reverse order.

2.4 Correlations of DNA Strings

DNA strings can be designed using correlation properties such that the string avoids the forbidden strings or sub-strings. In the case of DNA data storage, the block addresses are correspond to forbidden strings in the pool. We prefer to design DNA strings in which the part of the information is not encoded into the DNA sub-strings that are the same as the address of any DNA strings. This motivates to define self-uncorrelated DNA string and mutually uncorrelated DNA strings yazdi2015rewritable .

Definition 6

Consider two DNA strings ${\bf x}$ and ${\bf y}$ of length $n$ and $m$, respectively. The correlation of ${\bf x}$ and ${\bf y}$, denoted by ${\bf x}\circ{\bf y}$, is a binary string ${\bf a}$ = $(a_{1}\ a_{2}\ \ldots\ a_{n})$ of length $n$, where

$$a_{i}=\begin{cases}1&\mbox{ if }m+i-1<n\mbox{ and }{\bf x}(i,m-i-1)={\bf y}(1,m),\\ 0&\mbox{ if }m+i-1<n\mbox{ and }{\bf x}(i,m-i-1)\neq{\bf y}(1,m),\\ 1&\mbox{ if }m+i-1\geq n\mbox{ and }{\bf x}(i,n)={\bf y}(1,n-i+1),\mbox{ and }\\ 0&\mbox{ if }m+i-1\geq n\mbox{ and }{\bf x}(i,n)\neq{\bf y}(1,n-i+1).\end{cases}$$

For any DNA string ${\bf x}$ of length $n$, if ${\bf x}\circ{\bf x}$ = $(1\ \textbf{0}_{1,n-1})$ then the DNA string ${\bf x}$ is called self-uncorrelated DNA string. Further, for any two DNA strings ${\bf x}$ of length $n$ and ${\bf y}$ of length $m$, if ${\bf x}\circ{\bf y}$ = $\textbf{0}_{1,n}$ and ${\bf y}\circ{\bf x}$ = $\textbf{0}_{1,m}$ then the DNA strings ${\bf x}$ and ${\bf y}$ are called mutually uncorrelated DNA strings.

Example 6

Example For DNA strings ${\bf x}$ = $ACCATG$ of length $6$ bps and ${\bf y}$ = $CATG$ of length $4$ bps, the correlation ${\bf x}\circ{\bf y}$ = $ACCATG\circ CATG$ = $(0\ 0\ 1\ 0\ 0\ 0)$, where

$$\begin{array}[]{cccccccccccl}{\bf x}=&A&C&C&A&T&G&&&&&\\ {\bf y}=&C&A&T&G&&&&&&\hskip 14.22636pt0&\hskip 14.22636pt{\bf x}(1,4)\neq{\bf y}(1,4)\\ &&C&A&T&G&&&&&\hskip 14.22636pt0&\hskip 14.22636pt{\bf x}(2,5)\neq{\bf y}(1,4)\\ &&&C&A&T&G&&&&\hskip 14.22636pt1&\hskip 14.22636pt{\bf x}(3,6)={\bf y}(1,4)\\ &&&&C&A&T&G&&&\hskip 14.22636pt0&\hskip 14.22636pt{\bf x}(4,6)\neq{\bf y}(1,3)\\ &&&&&C&A&T&G&&\hskip 14.22636pt0&\hskip 14.22636pt{\bf x}(5,6)\neq{\bf y}(1,2)\\ &&&&&&C&A&T&G&\hskip 14.22636pt0&\hskip 14.22636pt{\bf x}(6,6)\neq{\bf y}(1,1).\end{array}$$

Also, the DNA string $ACAGT$ is self-uncorrelated because $ACAGT\circ ACAGT$ = $(1\ 0\ 0\ 0\ 0)$. Again, DNA strings $ACAGT$ and $AGCATT$ are mutually uncorrelated because $ACAGT\circ AGCATT$ = $(0\ 0\ 0\ 0\ 0)$ and $AGCATT\circ ACAGT$ = $(0\ 0\ 0\ 0\ 0\ 0)$.

Observe that ${\bf x}\circ{\bf y}$ and ${\bf y}\circ{\bf x}$ are not the same in general.

3 DNA Codes

In this section, we have discussed about the Hamming distance, codes, DNA codes and their properties that helps to reduce cost and errors during synthesis and sequencing physical DNA.

For any positive integers $n$ and $M$, a sub-set $\mathscr{C}\subseteq\mathcal{A}_{q}^{n}$ of size $M$ is called a code over the alphabet $\mathcal{A}_{q}$ with the $(n,M,d)$ parameters, where $d$ = $\min\{d({\bf x},{\bf y}):{\bf x},{\bf y}\in\mathscr{C}\ s.t.\ {\bf x}\neq{\bf y}\}$ is called the minimum distance and $d({\bf x},{\bf y})$ is the distance between the strings ${\bf x}$ and ${\bf y}$ in $\mathcal{A}_{q}^{n}$. Now, the Hamming distance between ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})$ and ${\bf y}$ = $(y_{1}\ y_{2}\ \ldots\ y_{n})$ in $\mathcal{A}_{q}^{n}$ is the size of the set $\{i:x_{i}\neq y_{i},\mbox{ and }1\leq i\leq n\}$. In this chapter, the minimum Hamming distance, and the Hamming distance between ${\bf x}$ and ${\bf y}$ are denoted by $d_{H}$ and $H({\bf x},{\bf y})$, respectively. Now, we define the DNA codes in Definition 7.

Definition 7

Any $(n,M,d_{H})$ code $\mathscr{C}_{DNA}$ defined over the alphabet $\Sigma_{DNA}$ is called DNA code with the minimum Hamming distance $d_{H}$, the length $n$, and the size $M$.

Example 7

Example The set $\mathscr{C}_{DNA}$ = $\{AACC,CCTT,AGGT\}\subset\Sigma_{DNA}^{4}$ is an $(n=4,M=3,d_{H}=3)$ DNA code, where $H(AACC,CCTT)$ = $4$, $H(CCTT,AGGT)$ = $3$, and $H(AACC,$ $AGGT)$ = $3$.

For any given integer $n$ ($\geq 1$), if ${\bf x},{\bf y}\in\Sigma_{DNA}^{n}$ then the following properties are satisfied.

• $H({\bf x},{\bf y}^{r})$ = $H({\bf x}^{r},{\bf y})$.

• $H({\bf x},{\bf y}^{c})$ = $H({\bf x}^{c},{\bf y})$.

• $H({\bf x},{\bf y}^{rc})$ = $H({\bf x}^{rc},{\bf y})$ = $H({\bf x}^{r},{\bf y}^{c})$ = $H({\bf x}^{c},{\bf y}^{r})$.

3.1 Constraints on DNA Codes

As discussed in doi:10.1089/10665270152530818 , while reading physical DNA corresponding to DNA string ${\bf x}$ in a pool of physical DNA, the non-specific hybridisation can be reduced if, for any physical DNA corresponding to the DNA string ${\bf y}$,

1. ${\bf x}$ and ${\bf y}$ are not sufficient similar,

2. ${\bf x}$ and ${\bf y}^{r}$ are not sufficient similar, and

3. ${\bf x}$ and ${\bf y}^{rc}$ are not sufficient similar.

The property 1, motivates to define Hamming constraint with distance parameter $d^{*}$, that ensures that both the physical DNA strings corresponding to DNA strings ${\bf x}$ and ${\bf y}$ are differ at at-least $d^{*}$ positions. Formally, Hamming constraint for any DNA code is defined in Section 3.1.

The property 2, motivates to define reverse constraint with distance parameter $d^{*}$. The reverse constraint ensures the physical DNA string corresponding to DNA string ${\bf x}$ is differ with the reverse string of the DNA string corresponding to DNA string ${\bf y}$ by at-least $d^{*}$ positions. The reverse constraint for any DNA code is defined in Section 3.1.

Further, the property 3 indicates that the physical DNA string corresponding to DNA string ${\bf x}$ should be differ with the reverse-complement DNA string of the DNA string corresponding to DNA string ${\bf y}$ by at-least $d^{*}$ positions. It motivates to define the reverse-complement constraint, and the reverse-complement constraint is defined in the Section 3.1.

Hamming Constraint with Distance Parameter $d^{*}$

An ($n,M,d_{H}$) DNA code satisfies the Hamming constraint with the distance parameter $d^{*}$ if the Hamming distance $H({\bf x},{\bf y})\geq d^{*}$ for any DNA codewords ${\bf x},{\bf y}\in\mathscr{C}_{DNA}$ and ${\bf x}\neq{\bf y}$ doi:10.1089/10665270152530818 .

Example 8

Example The $(4,3,3)$ DNA code $\mathscr{C}_{DNA}$ = $\{AACC,CCTT,AGGT\}$ satisfies the Hamming constraint with the distance parameter $3$. Also, the DNA code satisfies the Hamming constraint with distance parameters $1$ and $2$.

As given in Definition 7, for any $(n,M,d_{H})$ DNA code $\mathscr{C}_{DNA}$

$$d_{H}=\min\{H({\bf x},{\bf y}):{\bf x}\neq{\bf y}\mbox{ and }{\bf x},{\bf y}\in\mathscr{C}_{DNA}\},$$

and thus, $H({\bf x},{\bf y})\geq d_{H}$ for each ${\bf x}$ and ${\bf y}$ in $\mathscr{C}_{DNA}$ such that ${\bf x}\neq{\bf y}$. Therefore, the DNA code $\mathscr{C}_{DNA}$ satisfies the Hamming constraint with the distance parameter $d_{H}$ or simply, we call the property as the Hamming constraint. Hence, in general, any ($n,M,d_{H}$) DNA code $\mathscr{C}_{DNA}$ satisfies the Hamming constraint, $i.e.$, $H({\bf x},{\bf y})\geq d_{H}$ for ${\bf x},{\bf y}\in\mathscr{C}_{DNA}$ and ${\bf x}\neq{\bf y}$. Thus, all DNA code discussed in this chapter satisfy the Hamming constraint.

Reverse Constraint with Distance Parameter $d^{*}$

An ($n,M,d_{H}$) DNA code $\mathscr{C}_{DNA}$ satisfies reverse constraint with distance parameter $d^{*}$ if $H({\bf x}^{r},{\bf y})\geq d^{*}$ for any ${\bf x},{\bf y}\in\mathscr{C}_{DNA}$ and ${\bf x}^{r}\neq{\bf y}$ doi:10.1089/10665270152530818 .

3.1.1

Reverse constraint: Any DNA code that satisfies reverse constraint with distance property $d^{*}$ = $d_{H}$ is called simply DNA code with reverse constraint, $i.e.$, an ($n,M,d_{H}$) DNA code $\mathscr{C}_{DNA}$ satisfies reverse constraint if $H({\bf x}^{r},{\bf y})\geq d_{H}$ for any ${\bf x},{\bf y}\in\mathscr{C}_{DNA}$ and ${\bf x}^{r}\neq{\bf y}$. For simplicity, we call the reverse constraint as R constraint in the rest of the chapter.

Example 9

Example The $(4,3,3)$ DNA code $\mathscr{C}_{DNA}$ = $\{AACC,CCTT,AGGT\}$ satisfies the R constraint with the distance parameter $d^{*}$ = $2$, where $(AACC)^{r}$ = $CCAA$, $(CCTT)^{r}$ = $TTCC$, $(AGGT)^{r}$ = $TGGA$, and the Hamming distances

$$\begin{array}[]{ll}H((AACC)^{r},AACC)=4,&H((CCTT)^{r},AACC)=2,\\ H((AGGT)^{r},AACC)=4,&H((CCTT)^{r},CCTT)=4,\\ H((AGGT)^{r},CCTT)=4,&H((AGGT)^{r},AGGT)=2.\end{array}$$

Reverse-Complement Constraint with Distance Parameter $d^{*}$

An ($n,M,d_{H}$) DNA code $\mathscr{C}_{DNA}$ satisfies reverse-complement constraint with distance parameter $d^{*}$ if $H({\bf x}^{rc},{\bf y})\geq d^{*}$ for any ${\bf x},{\bf y}\in\mathscr{C}_{DNA}$ and ${\bf x}^{rc}\neq{\bf y}$ doi:10.1089/10665270152530818 .

3.1.1

Reverse-complement constraint: Any DNA code that satisfies reverse-complement constraint with distance property $d^{*}$ = $d_{H}$ is called simply DNA code with reverse-complement constraint or RC constraint, $i.e.$, an ($n,M,d_{H}$) DNA code $\mathscr{C}_{DNA}$ satisfies reverse-complement constraint if $H({\bf x}^{rc},{\bf y})\geq d_{H}$ for any ${\bf x},{\bf y}\in\mathscr{C}_{DNA}$ and ${\bf x}^{rc}\neq{\bf y}$. For simplicity, we call the reverse-complement constraint as RC constraint in the rest of the chapter.

Example 10

Example The $(4,3,3)$ DNA code $\mathscr{C}_{DNA}$ = $\{AACC,CCTT,AGGT\}$ satisfies the RC constraint with the distance parameter $2$, where $(AACC)^{rc}$ = $GGTT$, $(CCTT)^{rc}$ = $GGAA$, $(AGGT)^{rc}$ = $ACCT$, and the Hamming distances

$$\begin{array}[]{ll}H((AACC)^{rc},AACC)=4,&H((CCTT)^{rc},AACC)=2,\\ H((AGGT)^{rc},AACC)=3,&H((CCTT)^{rc},CCTT)=4,\\ H((AGGT)^{rc},CCTT)=3,&H((AGGT)^{rc},AGGT)=2.\end{array}$$

Fixed $GC$-Content Constraint with Weight $w$

A DNA code $\mathscr{C}_{DNA}$ satisfies fixed $GC$-content constraint with weight $w$, if $GC$-weight of each DNA string in the DNA code is $w$, $i.e.$, $w_{GC}({\bf x})$ = $w$ for each ${\bf x}\in\mathscr{C}_{DNA}$.

3.1.1

$GC$-content constraint: An ($n,M,d_{H}$) DNA code satisfies $GC$-content constraint if $GC$-content of all DNA strings in the DNA code are same and equal to either $\left\lfloor n/2\right\rfloor$ or $\left\lceil n/2\right\rceil$.

Example 11

Example The $(4,3,3)$ DNA code $\mathscr{C}_{DNA}$ = $\{AACC,CCTT,AGGT\}$ satisfies the Fixed $GC$-Content constraint with weight $2$. Infect, the $(4,3,3)$ DNA code $\mathscr{C}_{DNA}$ also satisfies $GC$-content constraint, since the weight $2$ = $\lfloor 4/2\rfloor$.

From Equation (1) and Equation (2), one can observe that, for given length $n$, the melting temperature of any physical DNA depends on $GC$-weight of the DNA string. Therefore, to avoid non-specific hybridisation while sequencing are sequencing physical DNA, DNA strings are preferred those have similar $GC$-weight. Also, synthesis and sequencing DNA strings with very high $GC$-weight or very low $GC$-weight pose problems 10.1093/nar/gkn425 . Again, one can observe that the total number of DNA strings of length $n$ and $GC$-weight $w$ is $\binom{n}{w}2^{n}$. For given $n$, the total number of DNA strings of length $n$ is maximum if $w$ = $\lfloor n/2\rfloor$ or $w$ = $\lceil n/2\rceil$. So, DNA codes with $GC$-content constraint are preferred.

Tandem-Free Constraint with Repeat-Length $\ell$

A DNA string ${\bf x}$ of length $n$ is called tandem-free DNA string with repeat-length $\ell$ if, for each $m$ = $1,2,\ldots,\ell$, two consecutive sub-strings each of length $m$ are not same, $i.e.$, ${\bf x}(i,i+m-1)\neq{\bf x}(i+m,i+2m-1)$ for $i=1,2,\ldots,n-2m+1$. Any DNA code satisfying tandem-free constraint with repeat-length $\ell$, if each DNA codeword of the DNA code is tandem-free DNA strings with repeat-length $\ell$.

3.1.1

Homopolymers-free constraint: Any DNA string is called Homopolymers-free, if the DNA string is tandem-free with repeat-length one, $i.e.$, any two nucleotides at consecutive positions are not same. Any DNA code with Homopolymer-free constraint is a DNA code in which all DNA codewords are tandem-free with repeat-length one.

3.1.2

A DNA string is free from Homopolymers of run-length $t$ if there is not exist a DNA sub-string of length $t$ such that all nucleotides of the DNA sub-string are identical.

Example 12

Example The DNA string ${\bf x}$ = $x_{1}x_{2}\ldots x_{12}$ = $TATCTATCAGAT$ is tandem-free with repeat-length $3$, because

• $x_{i}\neq x_{i+1}$ for $i=1,2,\ldots,11$,

• ${\bf x}(i,i+1)\neq{\bf x}(i+2,i+3)$ for $i=1,2,\ldots,9$,

• ${\bf x}(i,i+2)\neq{\bf x}(i+3,i+5)$ for $i=1,2,\ldots,7$, but

• ${\bf x}(1,4)={\bf x}(5,8)$.

Further, the $(4,3,3)$ DNA code $\mathscr{C}_{DNA}$ = $\{AACC,CCTT,AGGT\}$ satisfies the tandem-free constraint with repeat-length $3$.

Some DNA strings can not be synthesised without potential errors such as insertion, deletion and substitution errors. For example, DNA strings with Homopolymers of run-length more than two cannot be synthesised without errors. Therefore, for large integer $\ell$ ($\geq 1$), DNA codes that satisfies tandem-free constraint with repeat-length $\ell$ are preferred. Again, DNA codes with the Homopolymer-free constraint are also preferred to avoid such potential errors.

$\ell$-Free Secondary Structures Constraint

A DNA string ${\bf x}$ of length $n$ is called $\ell$-free secondary structures if there do not exist any two DNA sub-strings ${\bf x}(i,i+\ell-1)$ and ${\bf x}(j,j+\ell-1)$ such that ${\bf x}(i,i+\ell-1)\neq{\bf x}(j,j+\ell-1)^{s}$ and ${\bf x}(i,i+\ell-1)\neq{\bf x}(j,j+\ell-1)^{rs}$ for each $i\in\{1,2,\ldots,n-2\ell+1\}$, $j\in\{\ell+1,\ell+2,\ldots,n-\ell+1\}$ and $j-i>\ell$. An ($n,M,d_{H}$) DNA code satisfies the $\ell$-free secondary structures constraint if all DNA codewords of the DNA code is free from secondary structures of stem length $\ell$.

Example 13

Example All the codewords of the $(12,4,4)$ DNA code

$$\begin{split}\mathscr{C}_{DNA}&=\left\{ACACACACACAC,ACTCTCACTCTC,\right.\\ &\hskip 113.81102pt\left.CATCACTCACTC,TCACTCTCACTC\right\}\end{split}$$

are $3$-free secondary structures, and therefore, the DNA code satisfy $3$-free secondary structures constraint.

DNA strings with secondary structures are needed to unfold while reading in wet lab since the DNA is quit slow to react against chemical reagents. Thus, some additional energy and resources are needed to read the DNA, and it increase the cost. Therefore, DNA strings, and thus, DNA codes are preferred that avoids secondary structures.

Uncorrelated-Correlated Constraint

An ($n,M,d_{H}$) DNA code $\mathscr{C}_{DNA}$ is called mutually uncorrelated if

• each DNA codeword in $\mathscr{C}_{DNA}$ is self-uncorrelated, $i.e.$, ${\bf x}\circ{\bf x}$ = $(1\ \textbf{0}_{1,n-1})$ for all ${\bf x}\in\mathscr{C}_{DNA}$, and

• any two DNA codewords in $\mathscr{C}_{DNA}$ are mutually uncorrelated, $i.e.$, ${\bf x}\circ{\bf y}$ = $\textbf{0}_{1,n}$ for all ${\bf x},{\bf y}\in\mathscr{C}_{DNA}$ and ${\bf x}\neq{\bf y}$.

Example 14

Example For the ($5,3,3$) DNA code $\mathscr{C}_{DNA}$ = $\{ACAGT,AGCAT,ACGCG\}$, it can be observed that

• all the correlations $ACAGT\circ ACAGT$, $AGCAT\circ AGCAT$, $ACGCG\circ ACGCG$ are $(1\ \textbf{0}_{1,4})$, and

• correlations $ACAGT\circ AGCAT$, $AGCAT\circ ACGCG$, $ACAGT\circ ACGCG$ are $\textbf{0}_{1,5}$.

Thus, the DNA code is mutually uncorrelated.

Thermodynamic Constraint

A DNA code $\mathscr{C}_{DNA}$ satisfy the thermodynamic constraint if, for given real $\delta\geq 0$,

$$|\Delta G_{\bf x}-\Delta G_{\bf y}|\leq\delta\mbox{ for each }{\bf x},{\bf y}\in\mathscr{C}_{DNA},$$

where $|a|$ is the absolute value of the real number $a$, and the terms $\Delta G_{\bf x}$ and $\Delta G_{\bf y}$ represent the minimum free energy of the DNA strings ${\bf x}$ and ${\bf y}$, respectively. The details are given in DBLP:journals/corr/LimbachiyaRG16 ; doi:10.1089/10665270152530818 .

4 DNA Codes from Bijective Maps and the Hamming Distance

For any positive integers $q$ and $t$, consider two sets $\mathcal{A}_{q}$ and $\mathscr{D}\subseteq\Sigma_{DNA}^{t}$ such that size of both sets are the same and equal to $q$. Now, consider a bijective map

$$\varphi:\mathcal{A}_{q}\rightarrow\mathscr{D}.$$ (5)

For any ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})\in\mathcal{A}_{q}^{n}$, consider $\varphi({\bf x})=\varphi(x_{1})\varphi(x_{2})\ldots\varphi(x_{n})\in\Sigma_{DNA}^{nt}$. For any $\mathscr{C}\subset\mathcal{A}_{q}^{n}$, $\varphi(\mathscr{C})=\{\varphi({\bf x}):\mbox{ for each }{\bf x}\in\mathscr{C}\}$. Now, for any $x$ and $y$ in $\mathcal{A}_{q}$, we define a map

$$\begin{split}&d:\mathcal{A}_{q}\times\mathcal{A}_{q}\rightarrow\mathbb{R}\\ &d(x,y)=H(\varphi(x),\varphi(y)).\end{split}$$ (6)

Lemma 1

The map $d:\mathcal{A}_{q}\times\mathcal{A}_{q}\rightarrow\mathbb{R}$ such that $d(x,y)=H(\varphi(x),\varphi(y))$, as given in (6), is a distance.

Proof

From the bijective property of the map $\varphi$ and the distance property of the Hamming distance, one can observe the following.

Non Negative Property:

For any $\varphi(x)$ and $\varphi(y)$ in $\mathscr{D}$, $H(\varphi(x),\varphi(y))\geq 0$. Therefore, $d(x,y)\geq 0$ for any $x,y\in\mathcal{A}_{q}$.

Identity of Indiscernibles:

For any $\varphi(x)$ and $\varphi(y)$ in $\mathscr{D}$,

$$\begin{split}&H(\varphi(x),\varphi(y))=0\\ \Leftrightarrow\hskip 2.84544pt&\varphi(x)=\varphi(y).\end{split}$$

Thus, from the definitions of map $\varphi$ and the map $d$,

$$\begin{split}&d(x,y)=0\\ \Leftrightarrow\hskip 2.84544pt&x=y.\end{split}$$

Symmetric Property:

For any $\varphi(x)$ and $\varphi(y)$ in $\mathscr{D}$,

$$H(\varphi(x),\varphi(y))=H(\varphi(y),\varphi(x)).$$

And therefore, for any $x,y\in\mathcal{A}_{q}$,

$$d(x,y)=d(y,x).$$

Triangular Property:

For any $\varphi(x)$, $\varphi(y)$ and $\varphi(z)$ in $\mathscr{D}$,

$$H(\varphi(x),\varphi(z))\leq H(\varphi(x),\varphi(y))+H(\varphi(y),\varphi(z)).$$

This implies, for any $x,y,z\in\mathcal{A}_{q}$,

$$d(x,z)\leq d(x,y)+d(y,z).$$

Hence, the map given in (6) is a distance.

Now, for any ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})\in\mathcal{A}_{q}^{n}$ and ${\bf y}$ = $(y_{1}\ y_{2}\ \ldots\ y_{n})\in\mathcal{A}_{q}^{n}$, we define

$$d({\bf x},{\bf y})=\sum_{i=1}^{n}d(x_{i},y_{i}).$$

Now, for any ${\bf x},{\bf y}\in\mathcal{A}_{q}^{n}$, the distance

$$\begin{split}d({\bf x},{\bf y})=&\sum_{i=1}^{n}d(x_{i},y_{i})\\ =&\sum_{i=1}^{n}H(\varphi(x_{i}),\varphi(y_{i}))\\ =&H(\varphi({\bf x}),\varphi({\bf y})).\end{split}$$ (7)

For any code $\mathscr{C}$ over $\mathcal{A}_{q}$, the minimum distance

$$d=\min\{d({\bf x},{\bf y}):{\bf x},{\bf y}\in\mathscr{C}\mbox{ such that }{\bf x}\neq{\bf y}\}.$$ (8)

Now, a relation between the distance for any binary code and the Hamming distance for respective DNA code is given in Lemma 2.

Lemma 2

If the minimum distance is $d$ for any code $\mathscr{C}$ over $\mathcal{A}_{q}$, and the minimum Hamming distance is $d_{H}$ for the DNA code $\varphi(\mathscr{C})$ over $\mathscr{D}$, then $d$ = $d_{H}$.

Proof

From the bijection property of the map $\varphi:\mathcal{A}_{q}\rightarrow\mathscr{D}$, the map $\varphi:\mathcal{A}_{q}^{n}\rightarrow\mathscr{D}^{n}$ is also bijective for any integer $n\geq 1$. Now, from Equation (7),

$$\begin{split}&d({\bf x},{\bf y})=H({\bf x},{\bf y})\,\mbox{ for any }{\bf x},{\bf y}\in\mathcal{A}_{q}^{n}\\ \Rightarrow&\{d({\bf x},{\bf y}):{\bf x}\neq{\bf y}\mbox{ and }{\bf x},{\bf y}\in\mathscr{C}\}\\ &\hskip 56.9055pt=\{H({\bf x},{\bf y}):\varphi({\bf x})\neq\varphi({\bf y})\mbox{ and }\varphi({\bf x}),\varphi({\bf y})\in\varphi(\mathscr{C})\}\\ \Rightarrow&\min\{d({\bf x},{\bf y}):{\bf x}\neq{\bf y}\mbox{ and }{\bf x},{\bf y}\in\mathscr{C}\}\\ &\hskip 56.9055pt=\min\{H({\bf x},{\bf y}):\varphi({\bf x})\neq\varphi({\bf y})\mbox{ and }\varphi({\bf x}),\varphi({\bf y})\in\varphi(\mathscr{C})\}\\ \Rightarrow&d=d_{H}.\end{split}$$

Hence, it follows the proof.

Thus, one can obtain an isometry as given in Lemma 3 as follows.

Lemma 3

The map $\varphi:(\mathcal{A}_{q}^{n},d)\rightarrow(\mathscr{D}^{n},d_{H})$ is an isometry.

Proof

One can find that $d(x,y)$ = $H(\varphi(x),\varphi(y))$ for any $x,y\in\mathcal{A}_{q}$. Thus, for any ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})$ and ${\bf y}$ = $(y_{1}\ y_{2}\ \ldots\ y_{n})$ in $\mathcal{A}_{q}^{n}$,

$$\begin{split}d({\bf x},{\bf y})=&\sum_{i=1}^{n}d(x_{i},y_{i})\\ =&\sum_{i=1}^{n}H(\varphi(x_{i}),\varphi(y_{i}))\\ =&\ H(\varphi({\bf x}),\varphi({\bf y})).\end{split}$$

Thus, the result follows.

From the distance isometry and the map property, one can get the parameter of DNA code as given in Theorem 4.1.

Theorem 4.1

There exists $(t\cdot n,M,d_{H})$ DNA code $\varphi(\mathscr{C})$ for an $(n,M,d)$ code $\mathscr{C}$ over $\mathcal{A}_{q}$, where $d$ = $d_{H}$.

Proof

Consider an $(n,M,d)$ code $\mathscr{C}$ over $\mathcal{A}_{q}$. The map $\varphi:\mathcal{A}_{q}\rightarrow\mathscr{D}$ maps an element in $\mathcal{A}_{q}$ to a DNA string of length $t$, where $\mathscr{D}\subseteq\Sigma_{DNA}^{t}$. Therefore, the DNA codeword length of $\varphi(\mathscr{C})$ is $t\cdot n$. From the bijection property of the map $\varphi:\mathcal{A}_{q}\rightarrow\mathscr{D}$, the size of the DNA code $\varphi(\mathscr{C})$ is the same as the size of the code $\mathscr{C}$, $i.e.$, $M$. From Lemma 3, the result on distance holds.

In Lemma 4, Lemma 5, Lemma 6 and Lemma 7, properties on DNA strings with reverse, complement and reverse-complement DNA strings are given.

Lemma 4

For any ${\bf z}\in\varphi(\mathscr{C})$, if ${\bf z}^{r}\in\varphi(\mathscr{C})$ and ${\bf z}^{c}\in\varphi(\mathscr{C})$ then ${\bf z}^{rc}\in\varphi(\mathscr{C})$ for each $z\in\varphi(\mathscr{C})$.

Proof

For any string ${\bf z}$ = $(z_{1}\ z_{2}\ \ldots\ z_{n})$ in $\varphi(\mathscr{C})$, consider ${\bf z}^{r}$ = $(z_{n}\ z_{n-1}\ \ldots\ z_{1})$ and ${\bf z}^{c}$ = $(z_{1}^{c}\ z_{2}^{c}\ \ldots\ z_{n}^{c})$ in $\varphi(\mathscr{C})$. Now,

$$\begin{split}&{\bf z}=(z_{1}\ z_{2}\ \ldots\ z_{n})\in\varphi(\mathscr{C})\\ \implies&{\bf z}^{r}=(z_{n}\ z_{n-1}\ \ldots\ z_{1})\in\varphi(\mathscr{C})\\ \implies&({\bf z}^{r})^{c}=(z_{n}^{c}\ z_{n-1}^{c}\ \ldots\ z_{1}^{c})\in\varphi(\mathscr{C})\\ \implies&{\bf z}^{rc}\in\varphi(\mathscr{C})\end{split}$$

Hence, it follows the result.

Lemma 5

For any ${\bf x}\in\mathscr{C}$, DNA string $\varphi^{-1}(\varphi({\bf x})^{r})\in\mathscr{C}$ if and only if ${\bf z}^{r}\in\varphi(\mathscr{C})$ for each ${\bf z}\in\varphi(\mathscr{C})$.

Proof

For any ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})\in\mathscr{C}$, consider ${\bf z}$ = $\varphi({\bf x})$ = $\varphi(x_{1})\varphi(x_{2})\ldots\varphi(x_{n})$, and therefore, ${\bf z}^{r}$ = $\varphi({\bf x})^{r}$ = $\varphi(x_{n})^{r}\varphi(x_{n-1})^{r}\ldots\varphi(x_{1})^{r}$. Now,

$$\begin{split}&\varphi^{-1}(\varphi({\bf x})^{r})\in\mathscr{C}\\ \Leftrightarrow\hskip 8.53581pt&\varphi({\bf x})^{r}\in\varphi(\mathscr{C})\\ \Leftrightarrow\hskip 8.53581pt&{\bf z}^{r}\in\varphi(\mathscr{C})\end{split}$$

Hence, it follows the result.

Lemma 6

For any ${\bf x}\in\mathscr{C}$, DNA string $\varphi^{-1}(\varphi({\bf x})^{c})\in\mathscr{C}$ if and only if ${\bf z}^{c}\in\varphi(\mathscr{C})$ for each $z\in\varphi(\mathscr{C})$.

Proof

For any ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})\in\mathscr{C}$, consider ${\bf z}$ = $\varphi({\bf x})$ = $\varphi(x_{1})\varphi(x_{2})\ldots\varphi(x_{n})$, and therefore, ${\bf z}^{c}$ = $\varphi({\bf x})^{c}$ = $\varphi(x_{1})^{c}\varphi(x_{2})^{c}\ldots\varphi(x_{n})^{c}$. Now,

$$\begin{split}&\varphi^{-1}(\varphi({\bf x})^{c})\in\mathscr{C}\\ \Leftrightarrow\hskip 8.53581pt&\varphi({\bf x})^{c}\in\varphi(\mathscr{C})\\ \Leftrightarrow\hskip 8.53581pt&{\bf z}^{c}\in\varphi(\mathscr{C})\end{split}$$

Hence, it follows the result.

Lemma 7

For any ${\bf x}\in\mathscr{C}$, if $\varphi^{-1}(\varphi({\bf x})^{c})\in\mathscr{C}$ and $\varphi^{-1}(\varphi({\bf x})^{r})\in\mathscr{C}$ then ${\bf z}^{rc}\in\varphi(\mathscr{C})$ for each $z\in\varphi(\mathscr{C})$.

Proof

For any ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})\in\mathscr{C}$, consider ${\bf z}$ = $\varphi({\bf x})$ = $\varphi(x_{1})\varphi(x_{2})\ldots\varphi(x_{n})$. Therefore,

$${\bf z}^{r}=\varphi({\bf x})^{r}=\varphi(x_{n})^{r}\varphi(x_{n-1})^{r}\ldots\varphi(x_{1})^{r},$$

and

$${\bf z}^{c}=\varphi({\bf x})^{c}=\varphi(x_{1})^{c}\varphi(x_{2})^{c}\ldots\varphi(x_{n})^{c}.$$

Now,

$$\begin{split}&\varphi^{-1}(\varphi({\bf x})^{r}),\varphi^{-1}(\varphi({\bf x})^{c})\in\mathscr{C}\\ \Leftrightarrow\hskip 8.53581pt&\varphi({\bf x})^{r},\varphi({\bf x})^{c}\in\varphi(\mathscr{C})\\ \Leftrightarrow\hskip 8.53581pt&({\bf z}^{r})^{c}\in\varphi(\mathscr{C})\\ \Leftrightarrow\hskip 8.53581pt&{\bf z}^{rc}\in\varphi(\mathscr{C})\end{split}$$

Hence, it follows the result.

4.1 DNA Codes from the Map for the Ring $\mathbb{Z}_{4}+u\mathbb{Z}_{4}$ with $u^{2}$ = $2+2u$

For $t$ = $2$, consider $\mathscr{D}$ = $\Sigma_{DNA}^{2}$ and $\mathcal{A}_{q}$ = $\mathbb{Z}_{4}+u\mathbb{Z}_{4}$ with $u^{2}$ = $2+2u$. Then, the map as given in (5) and the distance as shown in (6) are $Gau$ map and $Gau$ distance, respectively, where $Gau$ map and $Gau$ distance are discussed in 8437313 ; limbachiyaDNA .

The Ring $\mathbb{Z}_{4}+u\mathbb{Z}_{4}$ with $u^{2}$ = $2+2u$

The ring $\mathbb{Z}_{4}+u\mathbb{Z}_{4}$ = $\{a+bu:a,b\in\mathbb{Z}_{4}\mbox{ and }u^{2}=2+2u\}$ of size $16$ is the finite commutative local chain ring. We denote the ring $\mathbb{Z}_{4}+u\mathbb{Z}_{4}$ with $u^{2}$ = $2+2u$ by $R$ in the remaining part of Section 4.1. For the ring $R$, zero divisors and unit elements are listed as follows.

• Zero divisors: $0$, $2$, $u$, $2+u$, $2u$, $2+2u$, $3u$, $2+3u$, and

• Unites: $1$, $3$, $1+u$, $3+u$, $1+2u$, $3+2u$, $1+3u$, $3+3u$.

The distinct ideals of the ring are as follows.

$$\begin{array}[]{ll}\langle 0\rangle&=\{0\}\\ \langle 2u\rangle&=\{0,2u\}\\ \langle 2\rangle&=\langle 2+2u\rangle=\{0,2,2u,2+2u\}\\ \langle u\rangle&=\langle 2+u\rangle=\langle 3u\rangle=\langle 2+3u\rangle=\{0,2,u,2+u,2u,2+2u,3u,2+3u\}\\ \langle 1\rangle&=\langle 3\rangle=\langle 1+u\rangle=\langle 3+u\rangle=\langle 1+2u\rangle=\langle 3+2u\rangle=\langle 1+3u\rangle=\langle 3+3u\rangle=R\\ \end{array}$$

Now, for any matrix $G$ with $k$ rows $\textbf{g}_{1},\textbf{g}_{2}\ldots\textbf{g}_{k}$ over the ring $R$, we denote

$$\langle G\rangle=\left\{\sum_{i=1}^{k}a_{i}\textbf{g}_{i}:a_{i}\in R\mbox{ for }i=1,2,\ldots,k\right\}.$$

Any matrix that can be deduced into

$$G=\left(\begin{array}[]{ccccc}I_{k_{0}}&B_{0,1}&B_{0,2}&B_{0,3}&B_{0,4}\\ 0&uI_{k_{1}}&uB_{1,2}&uB_{1,3}&uB_{1,4}\\ 0&0&2I_{k_{2}}&2B_{2,3}&2B_{2,4}\\ 0&0&0&2uI_{k_{3}}&2uB_{3,4}\\ \end{array}\right)=\left(\begin{array}[]{c}\textbf{g}_{1}\\ \textbf{g}_{2}\\ \vdots\\ \textbf{g}_{k}\\ \end{array}\right)$$ (9)

is called the matrix of type $\{k_{0},k_{1},k_{2},k_{3}\}$, where the blocks $B_{i,j}$ ($0\leq i<j\leq 4$) are defined over the ring $R$ and $k$ = $k_{0}+k_{1}+k_{2}+k_{3}$. For any matrix of type $\{k_{0},k_{1},k_{2},k_{3}\}$, the size of $\langle G\rangle$ is $16^{k_{0}}8^{k_{1}}4^{k_{2}}2^{k_{3}}$ choie2005codes . Any sub-module of $R^{n}$ is known as a linear code $\mathscr{C}$ over the ring $R$.

Proposition 2

The size of any linear code $\mathscr{C}$ over the ring $R$ with the generator matrix $G$ of type $\{k_{0},k_{1},k_{2},k_{3}\}$ is $16^{k_{0}}8^{k_{1}}4^{k_{2}}2^{k_{3}}$.

Example 15

Example Consider the matrix

$$G=\left(\begin{array}[]{ccccc}1&1&1&1&1\\ 0&u&u&u&u\\ 0&0&2&2&2\\ 0&0&0&2u&2u\\ \end{array}\right)$$

over the ring $R$. The matrix is of type $\{1,1,1,1\}$, and therefore, the size of the $\langle G\rangle$ is $16^{1}\cdot 8^{1}\cdot 4^{1}\cdot 2^{1}$ = $1024$, where

$$\begin{split}\langle G\rangle=&\left\{a_{1}(1\ 1\ 1\ 1\ 1)+a_{2}(0\ u\ u\ u\ u)+a_{3}(0\ 0\ 2\ 2\ 2)+\right.\\ &\hskip 71.13188pt\left.a_{4}(0\ 0\ 0\ 2u\ 2u):a_{1},a_{2},a_{3},a_{4}\in R\right\}.\end{split}$$

For ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})\in R^{n}$, we denote ${\bf x}^{r}$ = $(x_{n}\ x_{n-1}\ \ldots\ x_{1})\in R^{n}$.

The $Gau$ Map

Consider a bijective map $\varphi_{G}:R\rightarrow\Sigma_{DNA}^{2}$ such that Table 1 holds.

Table 1: The $Gau$ Map.

Ring element $x$	$0$	$1$	$2$	$3$	$u$	$1+u$	$2+u$	$3+u$
DNA image $\varphi_{G}(x)$	$AA$	$AG$	$GG$	$GA$	$TG$	$TA$	$CA$	$CG$
Ring element $x$	$2u$	$1+2u$	$2+2u$	$3+2u$	$3u$	$1+3u$	$2+3u$	$3+3u$
DNA image $\varphi_{G}(x)$	$CC$	$CT$	$TT$	$TC$	$GT$	$GC$	$AC$	$AT$

For any ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})\in R^{n}$, consider

$$\varphi_{G}({\bf x})=\varphi_{G}(x_{1})\varphi_{G}(x_{2})\ldots\varphi_{G}(x_{n})\in\Sigma_{DNA}^{2n}.$$

Then, for any $\mathscr{C}\subseteq R^{n}$, we define

$$\varphi(\mathscr{C})=\{\varphi_{G}({\bf x}):{\bf x}\in\mathscr{C}\}.$$

Now, the properties of the $Gau$ map $\varphi_{G}$ are as follows.

1. Reverse property: For each $x\in R$, $\varphi_{G}(x)^{r}$ = $\varphi_{G}(3x)$.

2. Complement property: For each $x\in R$, $\varphi_{G}(x)^{c}$ = $\varphi_{G}(x+(2+2u))$.

3. Reverse-complement property: For each $x\in R$, $\varphi_{G}(x)^{rc}$ = $\varphi_{G}(3x+(2+2u))$.

Also, some fundamental $Gau$ map properties are listed in Table 2.

Table 2: Some fundamental properties of the $Gau$ Map.

Sr. no.	Properties of $x\in R$	Properties of $\varphi_{G}(x)\in\Sigma_{DNA}^{2}$
1.	For each $x\in R$, $3x$ is unique	For each $\varphi_{G}(x)\in\Sigma_{DNA}^{2}$, $\varphi_{G}(x)^{r}$ is unique
2.	$x$ = $3x$ for $x=0,2,2u,2+2u$	$\varphi_{G}(x)$ = $\varphi_{G}(x)^{r}$ for $\varphi_{G}(x)$ = $AA$, $GG$, $CC$, $TT$
3.	For each $x\in R$, $x+(2+2u)$ is unique	For each $\varphi_{G}(x)\in\Sigma_{DNA}^{2}$, $\varphi_{G}(x)^{c}$ is unique
4.	For each $x\in R$, $x\neq x+(2+2u)$	For each $\varphi_{G}(x)\in\Sigma_{DNA}^{2}$, $\varphi_{G}(x)\neq\varphi_{G}(x)^{c}$
5.	For each $x\in R$, $3x+(2+2u)$ is unique	For each $\varphi_{G}(x)\in\Sigma_{DNA}^{2}$, $\varphi_{G}(x)^{rc}$ is unique
6.	$x$ = $3x+(2+2u)$ for $x=3+3u,1+u,3+u,1+3u$	$\varphi_{G}(x)$ = $\varphi_{G}(x)^{rc}$ for $\varphi_{G}(x)$ = $AT$, $TA$, $CG$, $GC$
7.	There is not exists $x$ in $R$ such that $x$ = $3x+(2+2u)$, and $x$ = $3x$	There is not exists $\varphi_{G}(x)$ in $\Sigma_{DNA}^{2}$ such that $\varphi_{G}(x)$ = $\varphi_{G}(x)^{rc}$, and $\varphi_{G}(x)$ = $\varphi_{G}(x)^{r}$

The $Gau$ Distance

In order to compute the Hamming distance on $\Sigma_{DNA}^{2}$, as given in (11), the sixteen elements of the ring are arranged in a square matrix $\mathcal{M}$ = $[m_{i,j}]$ such that

$$H(\varphi_{G}(m_{i,j}),\varphi_{G}(m_{i^{\prime},j^{\prime}}))=\begin{cases}0\ \mbox{ if }i=i^{\prime}\mbox{ and }j=j^{\prime},\\ 1\ \mbox{ if }i=i^{\prime}\mbox{ and }j\neq j^{\prime},\\ 1\ \mbox{ if }i\neq i^{\prime}\mbox{ and }j=j^{\prime},\mbox{ and }\\ 2\ \mbox{ if }i\neq i^{\prime}\mbox{ and }j\neq j^{\prime}.\\ \end{cases}$$ (10)

For the ring $R$ and set $\Sigma_{DNA}^{2}$, the square matrix $\mathcal{M}$ with the property as given in Equation 10 is not unique, and one of the possible arrangement for the square matrices $\mathcal{M}$ = $[m_{i,j}]$ and $\varphi_{G}(\mathcal{M})$ = $[\varphi_{G}(m_{i,j})]$ are

$$\begin{array}[]{cc}\mathcal{M}=&\begin{array}[]{cc}\begin{array}[]{cccccccccccccccccccccccccccccccc}A&&&&&&&G&&&&&&&C&&&&&&&T\end{array}&\\ \left(\begin{array}[]{cccc}0&3&2+u&1+u\\ 1&2&3+u&u\\ 2+3u&1+3u&2u&3+2u\\ 3+3u&3u&1+2u&2+2u\end{array}\right)&\begin{array}[]{c}A\\ G\\ C\\ T\end{array}\end{array}\end{array},$$ (11)

and

$$\varphi(\mathcal{M})=\left(\begin{array}[]{cccc}AA&GA&CA&TA\\ AG&GG&CG&TG\\ AC&GC&CC&TC\\ AT&GT&CT&TT\end{array}\right).$$

Thus, Gau distance is defined over the ring $R$ such that these properties are preserved.

For any $x,y\in R$, there exist $0\leq i,i^{\prime},j,j^{\prime}\leq 3$ such that let $x=m_{i,j}$ and $y=m_{i^{\prime},j^{\prime}}$. Now, $Gau$ distance is defined as

$$d_{G}(x,y)=\min\{1,i+3i^{\prime}(\mbox{mod }4)\}+\min\{1,j+3j^{\prime}(\mbox{mod }4)\},$$ (12)

where, one can observe that the terms

$$\min\{1,i+3i^{\prime}(\mbox{mod }4)\}=\begin{cases}0&\mbox{ if }i=i^{\prime},\\ 1&\mbox{ if }i\neq i^{\prime},\end{cases}$$

and

$$\min\{1,j+3j^{\prime}(\mbox{mod }4)\}=\begin{cases}0&\mbox{ if }j=j^{\prime},\\ 1&\mbox{ if }j\neq j^{\prime}.\end{cases}$$

Also, for any two elements $m_{i,j}$ and $m_{i,j^{\prime}}$ of the matrix $\mathcal{M}$ over the ring $R$, $m_{i,j}$ = $m_{i,j^{\prime}}$ if and only if $i$ = $i^{\prime}$ and $j$ = $j^{\prime}$.

Example 16

Example For $m_{0,1}$ = $3$ and $m_{3,2}$ = $1+3u$, the Gau distance

$$\begin{split}d_{G}(3,1+3u)=&\min\{1,0+3\cdot 3(\mbox{mod }4)\}+\min\{1,1+3\cdot 2(\mbox{mod }4)\}\\ =&\min\{1,1\}+\min\{1,1+3\}\\ =&2\end{split}$$

Now, one can establish a distance isometry between the ring $R$ and the set $\Sigma_{DNA}^{2}$ as given in Theorem 4.2.

Theorem 4.2

((8437313, , Theorem 1)) The $Gau$ map $\varphi_{G}:(R^{n},d_{G})\rightarrow(\Sigma_{DNA}^{2n},d_{H})$ is a distance preserving map.

Proof

Using computation, it can be easily observed that, for any $x$ and $y$ in $R$, $d_{G}(x,y)$ = $H(\varphi(x),\varphi(y))$. Therefore, for any ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})$ and ${\bf y}$ = $(y_{1}\ y_{2}\ \ldots\ y_{n})$ in $R^{n}$,

$$\begin{split}d_{G}({\bf x},{\bf y})=&\sum_{i=1}^{n}d_{G}(x_{i},y_{i})\\ =&\sum_{i=1}^{n}H(\varphi(x_{i}),\varphi(y_{i}))\\ =&H(\varphi({\bf x}),\varphi({\bf y})).\end{split}$$

Thus, the result follows.

Now, for any $x$ and $y$ in $R$, we define a distance

$$\begin{split}&d:R\times R\rightarrow\mathbb{R}\\ &d(x,y)=H(\varphi_{G}(x),\varphi_{G}(y)).\end{split}$$ (13)

Now, one can observe Lemma 8 as follows.

Lemma 8

For any $x,y\in R$, $d(x,y)$ = $d_{G}(x,y)$.

Proof

The result follows from Equation (13) and Theorem 4.2.

Properties of $Gau$ Map and $Gau$ Distance

In this section, we have discussed some conditions on codes defined over the ring $R$ that ensures the reverse and complement properties in the DNA codes obtained using $Gau$ map on the codes.

A linear property for reverse strings defined over the ring $R$ is given in Lemma 9 as follows.

Lemma 9

For any ${\bf x},{\bf y}\in R^{n}$, and any $a,b\in R$,

$$\varphi_{G}^{-1}(\varphi_{G}(a{\bf x}+b{\bf y})^{r})=a\varphi_{G}^{-1}(\varphi_{G}({\bf x})^{r})+b\varphi_{G}^{-1}(\varphi_{G}({\bf y})^{r}).$$

Proof

For any ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})$ and ${\bf y}$ = $(y_{1}\ y_{2}\ \ldots\ y_{n})$ in $R^{n}$ and $a,b\in R$, $\varphi_{G}(a{\bf x}+b{\bf y})$ = $\varphi_{G}(ax_{1}+by_{1})\varphi_{G}(ax_{2}+by_{2})\dots\varphi_{G}(ax_{n}+by_{n})$. Thus, $\varphi_{G}(a{\bf x}+b{\bf y})^{r}$ = $\varphi_{G}(ax_{n}+by_{n})^{r}\ \varphi_{G}(ax_{n-1}+by_{n-1})^{r}\dots\varphi_{G}(ax_{1}+by_{1})^{r}$. Therefore,

$$\begin{split}\varphi_{G}^{-1}(\varphi_{G}(a{\bf x}+&b{\bf y})^{r})\\ =&(\varphi_{G}^{-1}(\varphi_{G}(ax_{n}+by_{n})^{r})\ \varphi_{G}^{-1}(\varphi_{G}(ax_{n-1}+by_{n-1})^{r})\ \dots\\ &\hskip 159.3356pt\dots\ \varphi_{G}^{-1}(\varphi_{G}(ax_{1}+by_{1})^{r}))\\ =&(3ax_{n}+3by_{n}\ 3ax_{n-1}+3by_{n-1}\ \dots\ 3ax_{1}+3by_{1})\\ =&(a(3x_{n})+b(3y_{n})\ a(3x_{n-1})+b(3y_{n-1})\ \dots\ a(3x_{1})+b(3y_{1}))\\ =&(a\varphi_{G}^{-1}(\varphi_{G}(x_{n})^{r})+b\varphi_{G}^{-1}(\varphi_{G}(y_{n})^{r})\ a\varphi_{G}^{-1}(\varphi_{G}(x_{n-1})^{r})\\ &\hskip 19.91684pt+b\varphi_{G}^{-1}(\varphi_{G}(y_{n-1})^{r})\ \ldots\ a\varphi_{G}^{-1}(\varphi_{G}(x_{1})^{r})+b\varphi_{G}^{-1}(\varphi_{G}(y_{1})^{r}))\\ =&a(\varphi_{G}^{-1}(\varphi_{G}(x_{n})^{r})\ \varphi_{G}^{-1}(\varphi_{G}(x_{n-1})^{r})\ \dots\ \varphi_{G}^{-1}(\varphi_{G}(x_{1})^{r}))\\ &\hskip 28.45274pt+b((\varphi_{G}^{-1}(\varphi_{G}(y_{n})^{r})\ \varphi_{G}^{-1}(\varphi_{G}(y_{n-1})^{r})\dots\varphi_{G}^{-1}(\varphi_{G}(y_{1})^{r})))\\ =&a\varphi_{G}^{-1}(\varphi_{G}({\bf x})^{r})+b\varphi_{G}^{-1}(\varphi_{G}({\bf y})^{r}).\end{split}$$

It follows the result.

Example 17

Example For ${\bf x}$ = $(1\ 1\ 2u)\in R^{3}$, ${\bf y}$ = $(0\ 1\ u)\in R^{3}$, $a$ = $3u\in R$ and $b$ = $2\in R$,

$$\begin{split}&a{\bf x}+b{\bf y}=3u(1\ 1\ 2u)+2(0\ 1\ u)\\ &\hskip 31.2982pt=(3u\ 2+3u\ 2u)\hskip 28.45274pt(\because 6u^{2}=2u^{2}=2(2+2u)=0)\\ &\varphi_{G}(a{\bf x}+b{\bf y})=GTACCC\\ &\varphi_{G}(a{\bf x}+b{\bf y})^{r}=CCCATG\\ &\varphi_{G}^{-1}(\varphi_{G}(a{\bf x}+b{\bf y})^{r})=(2u\ 2+u\ u)\end{split}$$

On the other hand,

$$\begin{split}&\varphi_{G}({\bf x})=AGAGCC\\ &\varphi_{G}({\bf x})^{r}=CCGAGA\\ &\varphi_{G}^{-1}(\varphi_{G}({\bf x})^{r})=(2u\ 3\ 3)\\ &a\varphi_{G}^{-1}(\varphi_{G}({\bf x})^{r})=3u(2u\ 3\ 3)\\ &\hskip 59.75095pt=(0\ u\ u)\end{split}$$

Similarly,

$$b\varphi_{G}^{-1}(\varphi_{G}({\bf y})^{r})=(2u\ 2\ 0)$$

Therefore,

$$\begin{split}a\varphi_{G}^{-1}(\varphi_{G}({\bf x})^{r})+b\varphi_{G}^{-1}(\varphi_{G}({\bf y})^{r})&=(0\ u\ u)+(2u\ 2\ 0)\\ &=(2u\ 2+u\ u).\end{split}$$

Hence, it is clear that $\varphi_{G}^{-1}(\varphi_{G}(a{\bf x}+b{\bf y})^{r})$ = $a\varphi_{G}^{-1}(\varphi_{G}({\bf x})^{r})+b\varphi_{G}^{-1}(\varphi_{G}({\bf y})^{r})$.

Similarly one can generalise the Lemma 9 as Proposition 3.

Proposition 3

For any given positive integer $k$ and $i=1,2,\ldots,k$, if ${\bf x}_{i}\in R^{n}$, then $\varphi_{G}^{-1}(\varphi_{G}(\sum_{i=1}^{k}a_{i}{\bf x}_{i})^{r})=\sum_{i=1}^{k}a_{i}\varphi_{G}^{-1}(\varphi_{G}({\bf x}_{i})^{r})$, where $a_{i}\ \in R$.

Using the linear property as given in Proposition 3, a condition on generator matrix for linear code defined over the ring $R$ is obtained that ensures the the R constraint in respective DNA code.

Lemma 10

For any matrix

$$G=\left(\begin{array}[]{c}\textbf{g}_{1}\\ \textbf{g}_{2}\\ \vdots\\ \textbf{g}_{k}\end{array}\right)$$

with $k$ rows $\textbf{g}_{1}$, $\textbf{g}_{2}$, $\ldots$, $\textbf{g}_{k}$ over the ring $R$, the DNA code $\varphi_{G}(\langle G\rangle)$ contains the R DNA strings of each DNA codewords if and only if $\textbf{g}_{i}^{r}\in\langle G\rangle$ for each $i=1,2,\ldots,k$.

Proof

Consider a matrix $G$ with $k$ rows $\textbf{g}_{1},\textbf{g}_{2},\ldots,\textbf{g}_{k}$. For any ${\bf x}\in\langle G\rangle$, there exist some $a_{i}$ ($i=1,2,\ldots,k$) such that ${\bf x}$ = $\sum_{i=1}^{k}a_{i}\textbf{g}_{i}$.

$$\begin{split}&\varphi_{G}({\bf y})\in\varphi_{G}(\langle G\rangle)\\ \Leftrightarrow&{\bf y}\in\langle G\rangle\\ \Leftrightarrow&\sum_{i=1}^{k}a_{i}\textbf{g}_{i}\in\langle G\rangle\ \mbox{ for some }a_{i}\in R\mbox{ and }i=1,2,\ldots,k\\ \Leftrightarrow&\sum_{i=1}^{k}a_{i}\textbf{g}_{i}^{r}\in\langle G\rangle\hskip 14.22636pt\mbox{ given }\textbf{g}_{i}^{r}\in\langle G\rangle\mbox{ for each }i=1,2,\ldots,k\\ \Leftrightarrow&\sum_{i=1}^{k}a_{i}(3\textbf{g}_{i}^{r})\in\langle G\rangle\hskip 14.22636pt\mbox{ from closer property of }\langle G\rangle\\ \Leftrightarrow&\sum_{i=1}^{k}a_{i}\varphi_{G}^{-1}(\varphi_{G}(\textbf{g}_{i})^{r})\in\langle G\rangle\hskip 14.22636pt\mbox{ from reverse property of Gau map }\\ \Leftrightarrow&\varphi_{G}^{-1}\left(\varphi_{G}\left(\sum_{i=1}^{k}a_{i}{\bf x}_{i}\right)^{r}\right)\in\langle G\rangle\hskip 14.22636pt\mbox{ from Proposition \ref{linear on revers gen}}\\ \Leftrightarrow&\varphi_{G}^{-1}(\varphi_{G}({\bf y})^{r})\in\langle G\rangle\\ \Leftrightarrow&\varphi_{G}({\bf y})^{r}\in\varphi_{G}(\langle G\rangle)\end{split}$$

It follows the result.

Example 18

Example For the matrix

$$G=\left(\begin{array}[]{ccc}1&0&3\end{array}\right),$$

$k$ = $1$ and $\textbf{g}_{1}$ = $(1\ 0\ 3)$. Observe that $\textbf{g}_{1}^{r}$ = $(3\ 0\ 1)$ = $3(1\ 0\ 3)$ = $3\textbf{g}_{1}$, and therefore, $\textbf{g}_{1}^{r}\in\langle G\rangle$.

Also $\langle G\rangle$ = $\{(0\ 0\ 0)$, $(1\ 0\ 3)$, $(2\ 0\ 2)$, $(3\ 0\ 1)$, $(u\ 0\ 3u)$, $(2u\ 0\ 2u)$, $(3u\ 0\ u)$, $(1+u\ 0\ 3+3u)$, $(2+u\ 0\ 2+3u)$, $(3+u\ 0\ 1+3)$, $(1+2u\ 0\ 3+2u)$, $(2+2u\ 0\ 2+2u)$, $(3+2u\ 0\ 1+2u)$, $(1+3u\ 0\ 3+u)$, $(2+3u\ 0\ 2+u)$, $(3+3u\ 0\ 1+u)\}$.

Therefore, $\varphi(\langle G\rangle)$ = $\{AAAAAA$, $AGAAGA$, $GGAAGG$, $GAAAAG$, $TGAAGT$, $CCAACC$, $GTAATG$, $TAAAAT$, $CAAAAC$, $CGAAGC$, $CTAATC$, $TTAATT$, $TCAACT$, $GCAACG$, $ACAACA$, $ATAATA\}$. Note that, for each ${\bf z}\in\varphi(\langle G\rangle)$, ${\bf z}^{r}\in\varphi(\langle G\rangle)$.

Now, a condition on the linear code defined over the ring $R$ is discussed in Lemma 11 as follows.

Lemma 11

For any given matrix $G$ over the ring $R$, consider the DNA code $\varphi_{G}(\langle G\rangle)$. Then, for each ${\bf x}\in\varphi_{G}(\langle G\rangle)$, ${\bf x}^{c}\in\varphi_{G}(\langle G\rangle)$ if and only if $\textbf{2+2u}_{1,n}\in\langle G\rangle$.

Proof

For any ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})\in\langle G\rangle$, if $\textbf{2+2u}_{1,n}=(2+2u\ 2+2u\ \ldots\ 2+2u)\in\varphi_{G}(\langle G\rangle)$, then

$$\begin{split}&\varphi_{G}({\bf x})\in\varphi_{G}(\langle G\rangle)\\ \Rightarrow&{\bf x}\in\langle G\rangle\\ \Rightarrow&{\bf x}+(\textbf{2+2u}_{1,n})\in\langle G\rangle\\ \Rightarrow&(x_{1}\ x_{2}\ \ldots\ x_{n})+(2+2u\ 2+2u\ \ldots\ 2+2u)\in\langle G\rangle\\ \Rightarrow&(x_{1}+(2+2u)\ x_{2}+(2+2u)\ \ldots\ x_{n}+(2+2u))\in\langle G\rangle\\ \Rightarrow&\varphi_{G}(x_{1}+(2+2u)\ x_{2}+(2+2u)\ \ldots\ x_{n}+(2+2u))\in\varphi_{G}(\langle G\rangle)\\ \Rightarrow&\varphi_{G}(x_{1}+(2+2u))\varphi_{G}(x_{2}+(2+2u))\ldots\varphi_{G}(x_{n}+(2+2u))\in\varphi_{G}(\langle G\rangle)\\ \Rightarrow&\varphi_{G}(x_{1})^{c}\varphi_{G}(x_{2})^{c}\ldots\varphi_{G}(x_{n})^{c}\in\varphi_{G}(\langle G\rangle)\\ \Rightarrow&\varphi_{G}({\bf x})^{c}\in\varphi_{G}(\langle G\rangle).\end{split}$$

For the other side, if $\varphi_{G}({\bf x})^{c}\in\varphi_{G}(\langle G\rangle)$ for any $\varphi_{G}({\bf x})\in\varphi_{G}(\langle G\rangle)$ then

$$\begin{split}&\varphi_{G}(\textbf{0}_{1,n})\in\varphi_{G}(\langle G\rangle)\hskip 14.22636pt\mbox{ for particular }\textbf{0}_{1,n}=(0\ 0\ \ldots\ 0)\in\langle G\rangle\\ \Rightarrow&\varphi_{G}(\textbf{0}_{1,n})^{c}\in\varphi_{G}(\langle G\rangle)\\ &\hskip 85.35826pt\varphi_{G}({\bf x})^{c}\in\varphi_{G}(\langle G\rangle)\mbox{ for any }\varphi_{G}({\bf x})\in\varphi_{G}(\langle G\rangle)\\ \Rightarrow&\varphi_{G}(0)^{c}\varphi_{G}(0)^{c}\ldots\varphi_{G}(0)^{c}\in\varphi_{G}(\langle G\rangle)\\ \Rightarrow&\varphi_{G}(0+(2+2u))\varphi_{G}(0+(2+2u))\ldots\varphi_{G}(0+(2+2u))\in\varphi_{G}(\langle G\rangle)\\ \Rightarrow&\varphi_{G}(2+2u)\varphi_{G}(2+2u)\ldots\varphi_{G}(2+2u)\in\varphi_{G}(\langle G\rangle)\\ \Rightarrow&\varphi_{G}(\textbf{2+2u}_{1,n})\in\varphi_{G}(\langle G\rangle)\\ \Rightarrow&\textbf{2+2u}_{1,n}\in\langle G\rangle\end{split}$$

It follows the result.

Example 19

Example For the matrix

$$G=\left(\begin{array}[]{ccc}u&u&u\end{array}\right),$$

$k$ = $1$ and $\textbf{g}_{1}$ = $(u\ u\ u)$. Observe that $u\textbf{g}_{1}$ = $u(u\ u\ u)$ = $(2+2u\ 2+2u\ 2+2u)$, where $u^{2}$ = $2+2u$. But, $u\textbf{g}_{1}\in\langle G\rangle$, and thus, $(2+2u\ 2+2u\ 2+2u)\in\langle G\rangle$

Also note $\langle G\rangle$ = $\{(0\ 0\ 0)$, $(2\ 2\ 2)$, $(u\ u\ u)$, $(2+u\ 2+u\ 2+u)$, $(2u\ 2u\ 2u)$, $(2+2u\ 2+2u\ 2+2u)$, $(3u\ 3u\ 3u)$, $(2+3u\ 2+3u\ 2+3u)\}$.

Therefore, $\varphi(\langle G\rangle)$ = $\{AAAAAA$, $GGGGGG$, $TGTGTG$, $CACACA$, $CCCCCC$, $TTTTTT$, $GTGTGT$, $ACACAC\}$. Note that, for each ${\bf z}\in\varphi(\langle G\rangle)$, ${\bf z}^{rc}\in\varphi(\langle G\rangle)$.

Now, the parameter of DNA codes obtained from the codes over the ring $R$ using the $Gau$ map are calculated in Theorem 4.3 as follows.

Theorem 4.3

There is an $(2n,M,d_{H})$ DNA code $\varphi_{G}(\mathscr{C})$ for any $(n,M,d_{G})$ code $\mathscr{C}$ over the ring $R$, where $d_{H}$ = $d_{G}$.

Proof

The result on length of the DNA codeword follows from the fact that, for any ${\bf x}\in R^{n}$, $\varphi_{G}({\bf x})\in\Sigma_{DNA}^{2n}$. Similarly, the result on the size of the DNA code follows from the fact the $Gau$ map $\varphi_{G}$ is bijective. And, the result on distance follows from Lemma 8.

Constructions of DNA Codes

Motivated from the $r^{th}$ order binary Reed Muller code, DNA codes are constructed from Reed Muller type code over the ring $R$. For any integers $r$, $m$ ($0\leq r\leq m$) and any given element $z\in R$, the generator matrix of the code $\mathcal{R}(r,m,z)$ over the ring $R$ is

$$G_{r,m,z}=\begin{pmatrix}G_{r,m-1,z}&G_{r,m-1,z}\\ 0&G_{r-1,m-1,z}\\ \end{pmatrix},\ 1\leq r\leq m-1.$$

with

$$G_{m,m,z}\ =\left(\begin{array}[]{c}G_{m-1,m,z}\\ 0\ 0\ldots\ 0\ z\end{array}\right)$$

and $G_{0,m,z}$ = $\textbf{1}_{1,2^{m}}$. Now, in Lemma 12, the parameter of the $r^{th}$ order Reed Muller type code $\mathcal{R}(r,m,z)$ is calculated.

Lemma 12

Consider the $r^{th}$ order Reed Muller type code $\mathcal{R}(r,m,z)$ with the $(n,M,d_{G})$ parameter over the ring $R$. Then,

• the length

  $$n=2^{m}$$

• the size

  $$M=\left\{\,\begin{array}[]{ll}2^{\left(4\sum_{i=0}^{r}\binom{m}{i}-3\sum_{i=0}^{r-1}\binom{m-1}{i}\right)}&\mbox{ if }z\in\{2u\},\\ 2^{\left(4\sum_{i=0}^{r}\binom{m}{i}-2\sum_{i=0}^{r-1}\binom{m-1}{i}\right)}&\mbox{ if }z\in\{2,2+2u\},\\ 2^{\left(4\sum_{i=0}^{r}\binom{m}{i}-\sum_{i=0}^{r-1}\binom{m-1}{i}\right)}&\mbox{ if }z\in\{u,2+u,3u,2+3u\},\\ 2^{\left(4\sum_{i=0}^{r}\binom{m}{i}\right)}&\mbox{ if }z\mbox{ is a unit element of the ring }R,\end{array}\right.\\$$

  and

• the minimum Gau distance

  $$d_{G}=\left\{\,\begin{array}[]{ll}2^{m-r+1}&\mbox{ if }z\in\{2u,2,2+2u\},\\ 2^{m-r}&\mbox{ if }z\in R\backslash\{0,2u,2,2+2u\}.\end{array}\right.$$

Proof

For the generator matrix $G_{r,m,z}$, if we denote the number of columns in the matrix $G_{r,m,z}$ by $\ell(G_{r,m,z})$ then, from the generator matrix $G_{r,m,z}$, $\ell(G_{r,m,z})$ = $2\ell(G_{r,m-1,z})$ with the condition $\ell(G_{0,m,z})$ = $2^{m}$ and $\ell(G_{m,m,z})$ = $\ell(G_{m-1,m,z})$. after solving the difference equation, we have $\ell(G_{r,m,z})$ = $2^{m}$, and it follows the result on size of the code $\mathcal{R}(r,m,z)$. Note, the total number of rows of the matrix $G_{r,m,z}$ is $\sum_{i=0}^{r}\binom{m}{i}$. Also, all the nonzero entry of any given row of the generator matrix $G_{r,m,z}$ are same and it is either $1$ or the element $z$. From recurrence, one can calculate that the total number of rows containing the element $z$ is $\sum_{i=0}^{r-1}\binom{m-1}{i}$. Thus, the matrix $G_{r,m,z}$ is of

• type $\left\{\sum_{i=0}^{r}\binom{m}{i}-\sum_{i=0}^{r-1}\binom{m-1}{i},0,0,\sum_{i=0}^{r-1}\binom{m-1}{i}\right\}$ for $z\in\{2u\}$,

• type $\left\{\sum_{i=0}^{r}\binom{m}{i}-\sum_{i=0}^{r-1}\binom{m-1}{i},0,\sum_{i=0}^{r-1}\binom{m-1}{i},0\right\}$ for $z\in\{2,2+2u\}$,

• type $\left\{\sum_{i=0}^{r}\binom{m}{i}-\sum_{i=0}^{r-1}\binom{m-1}{i},\sum_{i=0}^{r-1}\binom{m-1}{i},0,0\right\}$ for $z\in\{u,2+u,3u,2+3u\}$, and

• type $\left\{\sum_{i=0}^{r}\binom{m}{i},0,0,0\right\}$ for any unit element $z$ in the ring $R$.

Hence, the result on code size holds from Proposition 2. Now, from symmetry of the matrix $G_{r,m,z}$, any two codewords in $\mathcal{R}(r,m,z)$ are differ at least at $2^{m-r}$ positions. Therefore, if $d_{z}$ = $\min\{d_{G}(x,y):x\in R\mbox{ and }y\in\langle z\rangle\}$ then the minimum $Gau$ distance $d_{G}\geq 2^{m-r}d_{z}$, since $d_{G}(x,y)\geq H(x,y)$ for any $x,y\in R$. Consider two codewords $\textbf{0}_{1,2^{m}}$, all zero codeword, and $\textbf{0}_{1,2^{m}-r}\ {\bf z}_{1,r})$, last $r$ positions are $z$ and remaining are zero, in $\mathcal{R}(r,m,z)$. Then, the $Gau$ distance between these two codewords are $2^{m-r}d_{z}$, since $d_{z}\geq 1$. Thus, from the bound $d_{G}\geq 2^{m-r}d_{z}$, $d_{G}$ = $2^{m-r}d_{z}$. Hence, it follows the result on distance for various $z$.

Now, the properties of the $r^{th}$ order Reed Muller type code $\mathcal{R}(r,m,z)$ is given in Lemma 13.

Lemma 13

The $r^{th}$ order Reed Muller type code $\mathcal{R}(r,m,z)$ with the generator matrix $G_{r,m,z}$ satisfies

• $\textbf{2+2u}_{1,2^{m}}\in\langle G_{r,m,z}\rangle$, and

• $\textbf{g}_{i}^{r}\in\langle G_{r,m,z}\rangle$ for each row $\textbf{g}_{i}$ ($i=1,2,\ldots,k$).

Proof

For any code $\mathcal{R}(r,m,z)$ with the generator matrix $G_{r,m,z}$, the first row of $G_{r,m,z}$ is all one string, $i.e.$, $\textbf{g}_{1}$ = $\textbf{1}_{1,2^{m}}$, and therefore, the string $\textbf{1}_{1,2^{m}}\in\langle G_{r,m,z}\rangle$. Thus, from closure property, $(2+2u)\textbf{1}_{1,2^{m}}\in\langle G_{r,m,z}\rangle$, and thus, $\textbf{{2+2u}}_{1,2^{m}}\in\langle G_{r,m,z}\rangle$. It follows the first part of the result. From symmetry of the matrix $G_{r,m,z}$, it is easy to observe that, for each row $\textbf{g}_{i}$ ($i=1,2,\ldots,k$) if the matrix $G_{r,m,z}$, the reverse $\textbf{g}_{i}^{r}$ belongs to $\langle G_{r,m,z}\rangle$. Hence, it follows the result.

Now, the properties of the DNA code obtained from the $r^{th}$ order Reed Muller type code $\mathcal{R}(r,m,z)$ is given in Theorem 4.4.

Theorem 4.4

For any $(n,M,d_{H})$ DNA code $\varphi_{G}(\mathcal{R}(r,m,z))$,

• Length:

  $$n=2^{m+1}$$

• Size:

  $$M=\left\{\,\begin{array}[]{ll}2^{\left(4\sum_{i=0}^{r}\binom{m}{i}-3\sum_{i=0}^{r-1}\binom{m-1}{i}\right)}&\mbox{ if }z\in\{2u\},\\ 2^{\left(4\sum_{i=0}^{r}\binom{m}{i}-2\sum_{i=0}^{r-1}\binom{m-1}{i}\right)}&\mbox{ if }z\in\{2,2+2u\},\\ 2^{\left(4\sum_{i=0}^{r}\binom{m}{i}-\sum_{i=0}^{r-1}\binom{m-1}{i}\right)}&\mbox{ if }z\in\{u,2+u,3u,2+3u\},\\ 2^{\left(4\sum_{i=0}^{r}\binom{m}{i}\right)}&\mbox{ if }z\mbox{ is a unit element of the ring }R,\end{array}\right.\\$$

• Minimum Hamming distance:

  $$d_{H}=\left\{\,\begin{array}[]{ll}2^{m-r+1}&\mbox{ if }z\in\{2,2u,2+2u\},\\ 2^{m-r}&\mbox{ if }z\in R\backslash\{0,2,2u,2+2u\}.\end{array}\right.$$

Further, the DNA code $\varphi_{G}(\mathcal{R}(r,m,z))$ is closed with R and RC DNA strings.

Proof

The result on parameters of the DNA code $\varphi_{G}(\mathcal{R}(r,m,z))$ follows from Lemma 12 and Theorem 4.3. The result on reverse and reverse-complement properties follow from Lemma 10, Lemma 11 and Lemma 13.

From Theorem 4.4, the DNA code $\varphi_{G}(\mathcal{R}(r,m,z))$ satisfies

• Hamming constraint,

• R constraint, and

• RC constraint.

4.2 DNA Codes from the Bijective Map over the Quinary Field

For $t$ = $2$, consider $\mathscr{D}$ = $\{AA,AC,CA,CC,TC\}\subset\Sigma_{DNA}^{2}$ and $\mathcal{A}_{q}$ = $\mathbb{Z}_{5}$. Then, the map as given in (5) and the distance as shown in (6) are the map and the distance discussed in 9214530 . We denote the set $\{AA,AC,CA,CC,TC\}$ by $\Sigma$ in Section 4.2.

The Bijective Map

Consider a bijective map $\varphi:\mathbb{Z}_{5}\rightarrow\Sigma$ such that Table 3 holds.

Table 3: The Bijective Map.

Field element $x$	$0$	$1$	$2$	$3$	$4$
DNA image $\varphi(x)$	$CC$	$CA$	$AC$	$AA$	$TC$

For any ${\bf x}$ = $(x_{1}\ x_{2}\ \ldots\ x_{n})\in\mathbb{Z}_{5}^{n}$, consider $\varphi({\bf x})=\varphi(x_{1})\varphi(x_{2})\ldots\varphi(x_{n})\in\Sigma^{n}$. For any $\mathscr{C}\subseteq\mathbb{Z}_{5}^{n}$, $\varphi(\mathscr{C})=\{\varphi({\bf x}):{\bf x}\in\mathscr{C}\}$. Now, the properties of the map $\varphi$ as following.

Lemma 14

Any DNA string defined over $\Sigma$ does not from any secondary structure with stems of length more than two.

Proof

For $x_{i}\in\Sigma_{DNA}$ $(i=1,2,\ldots,2n)$ a DNA string ${\bf x}$ = $x_{1}x_{2}\ldots x_{2n}\in\Sigma^{n}$, consider a set $S_{\bf x}$ = $\{x_{i}x_{i+1}x_{i+2}:\mbox{ for }i=1,2,\ldots,2n-2\}\subseteq\Sigma_{DNA}^{3}$. Then, for any ${\bf x}$ in $\Sigma^{n}$, $S_{\bf x}\subseteq\left\{AAA,AAC,ACA,CAA,CCA,CAC,ACC,CCC,TCA,TCC,TCT,ATC\right.$, $\left.CTC,AAT,ACT,CAT,CCT,TCT\right\}$ = $S$. Now one can easily observe that, for any $z\in S$, $z^{s}$ and $z^{rs}$ are not belong to the set $S$. Since any sub-string of length $3$ bps does not have its secondary-complement and reverse-secondary-complement DNA sub-strings in the DNA string, therefore, the DNA string is free from secondary-complement and reverse-secondary-complement DNA sub-strings of length more than $2$ bps. Thus, from Remark 1, the DNA string is independent from secondary structures of stem length more than two.

Note 1

In 9214530 , authors have considered only reverse-secondary-complement DNA sub-strings to analysis secondary structures for any DNA string, and thus, in (9214530, , Lemma 3), they have concluded that any DNA string in $\Sigma^{n}$ is free from secondary structures of stem length more than one.

The Distance

For any $x$ and $y$ in $\mathbb{Z}_{5}$, we define the distance

$$\begin{split}&d:\mathbb{Z}_{5}\times\mathbb{Z}_{5}\rightarrow\mathbb{R}\\ &d(x,y)=H(\varphi(x),\varphi(y)).\end{split}$$ (14)

Now, an isometry between $\mathbb{Z}_{5}^{n}$ and $\Sigma^{n}$ is given in Lemma 15.

Lemma 15

The map $\varphi:(\mathbb{Z}_{5}^{n},d)\rightarrow(\Sigma^{n},d_{H})$ is an isometry.

Proof

The result follows from Lemma 3.

From Lemma 15, one can calculate the parameters of constricted DNA codes as given in Theorem 4.5.

Theorem 4.5

if $\mathscr{C}$ is an $(n,M,d)$ code over $\mathbb{Z}_{5}$ then there exists a DNA code $\varphi(\mathscr{C})$ with the parameter $(2n,M,d_{H})$, where $d$ = $d_{H}$.

Proof

The proof of the theorem follows from Theorem 4.1.

A distance property on DNA strings defined over $\Sigma$ is given in Lemma 16.

Lemma 16

For any DNA strings ${\bf x}$ and ${\bf y}$ each of length $n$ defined over $\Sigma$, the Hamming distance $H({\bf x},{\bf y}^{c})\geq n$.

Proof

For any $x,y\in\Sigma$, note the Hamming distance $H(x,y^{c})\geq 1$. Therefore,

$$\begin{split}H({\bf x},{\bf y}^{c})=&\sum_{i=1}^{n}H(x_{i},y_{i}^{c})\\ \geq&n.\end{split}$$

Hence, it follows the result.

Now, an instant result on distance of obtained DNA codes using the Lemma 16 as given in Lemma 17.

Lemma 17

For any ($n,M,d$) code $\mathscr{C}$ over $\mathbb{Z}_{5}$, if the minimum distance $d\leq n$ then the DNA code $\varphi(\mathscr{C})$ satisfies RC constraint, .

Proof

Note that $(AA)^{rc}$ = $TT$, $(AC)^{rc}$ = $GT$, $(CA)^{rc}$ = $TG$, $(CC)^{rc}$ = $GG$ and $(TC)^{rc}$ = $GA$. Thus, for any $x$ and $y$ in the set $\Sigma$, the minimum Hamming distance $H(x,y^{rc})\geq 1$. Therefore, the minimum Hamming distance

$$H({\bf x},{\bf y}^{rc})\geq n\geq d\mbox{ for }{\bf x},{\bf y}\in\Sigma^{n}.$$

Now, if $d\leq n$, then, from Lemma 15, for $\varphi(\Sigma^{n})$, the minimum Hamming distance $d_{H}\leq n$, and therefore, $d_{H}\leq H({\bf x},{\bf y}^{rc})$ for each ${\bf x},{\bf y}\in\Sigma^{n}$, where

$$d_{H}=\min\{H({\bf x},{\bf y}):{\bf x},{\bf y}\in\varphi(\Sigma^{n})\mbox{ and }{\bf x}\neq{\bf y}\}.$$

Hence, for any $(2n,M,d_{H}^{*})$ DNA code $\mathscr{C}_{DNA}\subseteq\varphi(\Sigma^{n})$, $d_{H}^{*}\leq H({\bf x},{\bf y}^{rc})$ for each ${\bf x},{\bf y}\in\mathscr{C}_{DNA}$, where

$$d_{H}^{*}=\min\{H({\bf x},{\bf y}):{\bf x},{\bf y}\in\mathscr{C}_{DNA}\mbox{ and }{\bf x}\neq{\bf y}\}.$$

It follows the result.

Constructions of DNA Codes

For alphabet size five, from the family of linear codes constructed in BIER198747 , family of DNA codes are constructed in 9214530 . For any integer $k$ = $2,3,4,5$, the generator matrix for the code is given by

$$G_{k}=\left(\begin{array}[]{ccccc}\textbf{1}_{1,4^{k-2}}&\textbf{2}_{1,4^{k-2}}&\textbf{3}_{1,4^{k-2}}&\textbf{4}_{1,4^{k-2}}\\ G_{k-1}&G_{k-1}&G_{k-1}&G_{k-1}\end{array}\right)\mbox{ for }k=3,4,5,$$

with the initial case

$$G_{2}=\left(\begin{array}[]{cccc}1&1&1&1\\ 1&2&3&4\end{array}\right).$$

Using computation, one can easily obtain the Proposition 4 as follows.

Proposition 4

For $k=2,3,4,5$, if the code $\langle G_{k}\rangle$ is an $(n,M,d)$ code on $\mathbb{Z}_{5}$ then

• the length $n=4^{k-1}$,

• the size $M=5^{k}$, and

• the minimum distance $d=3\cdot 4^{k-2}$.

Now, one can obtained the parameters of DNA codes as given in Theorem 4.6.

Theorem 4.6

For $k=2,3,4,5$, the DNA code $\varphi(\langle G_{k}\rangle)$ is $(2^{2k-1},5^{k},3\cdot 4^{k-2})$ code.

Proof

The result can be obtained from Theorem 4.5 and Proposition 4.

From computation, one can obtain the result on the Hamming distance between DNA string and R DNA string as given in Proposition 5.

Proposition 5

For all ${\bf x}$ and ${\bf y}$ of the DNA code $\varphi(\langle G_{k}\rangle)$ $k=2,3,4,5$, the Hamming distance $H({\bf x},{\bf y}^{rc})\geq 2^{2k-3}$.

Now, the DNA code $\varphi(\langle G_{k}\rangle)$ $k=2,3,4,5$,

• has the parameters $(2^{2k-1},5^{k},3\cdot 4^{k-2})$ (from Theorem 4),

• satisfies the RC constraint (from Lemma 17), and

• $H({\bf x},{\bf y}^{rc})\geq 2^{2k-3}$ for each ${\bf x},{\bf y}\in\langle G_{k}\rangle$ (from Proposition 5).

Further,

• all DNA codewords of the DNA code $\varphi(\langle G_{k}\rangle)$ ($k=2,3,4,5$) are independent to the secondary structures of stem length two (from Lemma 14), and

• DNA strings obtained from concatenation of codewords of the DNA code $\varphi(\langle G_{k}\rangle)$ is also independent to the secondary structures of stem length two.

5 The Non-Homopolymer Map

In this section, we have established Non-Homopolymer map and distance. And also studied their properties in this section. Further, we have obtained DNA codes those are tandem-free and satisfy $GC$-content, R and RC constraints.

5.1 DNA Codes from the Non-Homopolymer Map

$\ell$ order Non-Homopolymer map: For given any integer $\ell$ ($\geq 1$) and ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$ such that ${\bf x}\neq{\bf y}$, consider $\mathscr{S}$ = $\{{\bf x},{\bf y},{\bf x}^{c},{\bf y}^{c}\}$. Now, define a map

$$\psi:\mathbb{Z}_{2}\times\mathscr{S}\rightarrow\mathscr{S}$$

such that

$$\begin{array}[]{llll}\psi(0,{\bf x})={\bf y},&\psi(0,{\bf x}^{c})={\bf y}^{c},&\psi(0,{\bf y})={\bf x}^{c},&\psi(0,{\bf y}^{c})={\bf x},\\ \psi(1,{\bf x})={\bf y}^{c},&\psi(1,{\bf x}^{c})={\bf y},&\psi(1,{\bf y})={\bf x},&\psi(1,{\bf y}^{c})={\bf x}^{c}.\end{array}$$

For any a = $(a_{1}\ a_{2}\ \ldots\ a_{n})\in\mathbb{Z}_{2}^{n}$, consider

$$\begin{split}&\psi(\textbf{a})=f(a_{1})\psi(a_{2},f(a_{1}))\psi(a_{3},\psi(a_{2},f(a_{1})))\ldots\\ &\hskip 85.35826pt\ldots\psi(a_{n},\psi(a_{n-1}\ldots\psi(a_{2},f(a_{1})\ldots)))\in\mathscr{S}^{n}\end{split}$$ (15)

where $f:\mathbb{Z}_{2}\rightarrow\{{\bf x}^{c},{\bf x}\}$ such that $f(0)$ = ${\bf x}$ and $f(1)$ = ${\bf x}^{c}$. Again, for any a = $(a_{1}\ a_{2}\ \ldots\ a_{n})\in\mathbb{Z}_{2}^{n}$, if $\psi({\bf a})$ = $u_{1}u_{2}\ldots u_{n}$ in $\mathscr{S}^{n}$ then, using recurrence,

$$u_{i}=\begin{cases}\psi(a_{i},u_{i-1})&\mbox{ for }i=2,3,\ldots,n\mbox{ and }\\ f(a_{1})&\mbox{ for }i=1.\end{cases}$$

Now, for any $\mathscr{C}\subseteq\mathbb{Z}_{2}^{n}$, $\psi(\mathscr{C})=\{\psi({\bf x}):{\bf x}\in\mathscr{C}\}$.

Example 20

Example If ${\bf x}$ = $ATA$ and ${\bf y}$ = $CGC$ then the binary string $(0\ 0\ 0\ 0)$ is encoded into a DNA string such that

$$\begin{array}[]{ccllll}\psi((0\ 0\ 0\ 0))&=&f(0)&\psi(0,f(0))&\psi(0,\psi(0,f(0)))&\psi(0,\psi(0,\psi(0,f(0))))\\ &=&{\bf x}&\psi(0,{\bf x})&\psi(0,\psi(0,{\bf x}))&\psi(0,\psi(0,\psi(0,{\bf x})))\\ &=&{\bf x}&{\bf y}&\psi(0,{\bf y})&\psi(0,\psi(0,{\bf y}))\\ &=&{\bf x}&{\bf y}&{\bf x}^{c}&\psi(0,{\bf x}^{c})\\ &=&{\bf x}&{\bf y}&{\bf x}^{c}&{\bf y}^{c}\\ &=&ATA&CGC&TAT&GCG\end{array}$$

Thus, $\psi((0\ 0\ 0\ 0))$ = $ATACGCTATGCG$. Again, for ${\bf a}$ = $(0\ 0\ 0\ 0)$, observe $u_{1}$ = $f(0)$ = ${\bf x}$, $u_{2}$ = $\psi(0,u_{1})$ = ${\bf y}$, $u_{3}$ = $\psi(0,u_{2})$ = ${\bf x}^{c}$ and $u_{4}$ = $\psi(0,u_{3})$ = ${\bf y}^{c}$. Therefore, $\psi((0\ 0\ 0\ 0))$ = $u_{1}u_{2}u_{3}u_{4}$ = ${\bf x}{\bf y}{\bf x}^{c}{\bf y}^{c}$. Similarly,

$$\begin{array}[]{cll}\psi((0\ 0\ 1\ 1))&={\bf x}{\bf y}{\bf x}{\bf y}^{c}&=ATACGCATAGCG,\\ \psi((1\ 1\ 0\ 0))&={\bf x}^{c}{\bf y}{\bf x}^{c}{\bf y}^{c}&=TATCGCTATGCG,\mbox{ and }\\ \psi((1\ 1\ 1\ 1))&={\bf x}^{c}{\bf y}{\bf x}{\bf y}^{c}&=TATCGCATAGCG.\end{array}$$

Thus, the binary code

$$\mathscr{C}=\{(0\ 0\ 0\ 0),(0\ 0\ 1\ 1),(1\ 1\ 0\ 0),(1\ 1\ 1\ 1)\}$$

is encoded into the $(12,4,3)$ DNA code

$$\begin{split}&\left\{ATACGCTATGCG,ATACGCATAGCG,TATCGCTATGCG,\right.\\ &\hskip 199.16928pt\left.TATCGCATAGCG\right\}.\end{split}$$

Observe that the binary code $\mathscr{C}$ is a linear code with the generator matrix

$$G=\begin{pmatrix}0&0&1&1\\ 1&1&0&0\end{pmatrix}.$$

For any tandem-free DNA string, the properties of the reverse, the complement and the RC DNA strings are given in Proposition 6, Proposition 7 and Proposition 8 as follows.

Proposition 6

A DNA string ${\bf x}$ is tandem-free DNA string with repeat-length $\ell$ if and only if ${\bf x}^{r}$ is tandem-free DNA string with repeat-length $\ell$.

Proposition 7

A DNA string ${\bf x}$ is tandem-free DNA string with repeat-length $\ell$ if and only if ${\bf x}^{c}$ is tandem-free DNA string with repeat-length $\ell$.

Proposition 8

A DNA string ${\bf x}$ is tandem-free DNA string with repeat-length $\ell$ if and only if ${\bf x}^{rc}$ is tandem-free DNA string with repeat-length $\ell$.

Example 21

Example For the tandem-free DNA string $ATACGCTATGCG$ with repeat-length $6$,

• the R DNA string $GCGTATCGCATA$ is the tandem-free DNA string with repeat-length $6$,

• the complement DNA string $TATGCGATACGC$ is the tandem-free DNA string with repeat-length $6$, and

• the RC DNA string $CGCATAGCGTAT$ is the tandem-free DNA string with repeat-length $6$.

In Lemma 18, a property on a tandem-free DNA string is discussed that helps to ensure the property in DNA strings with larger length.

Lemma 18

For any integers $\ell$ and $n$ ($2\ell\leq n$) and some ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$, any binary string of length $n$ will encode into a tandem-free DNA string with repeat-length $\ell$ using the $\ell$ order Non-Homopolymer map, if the DNA strings ${\bf x}{\bf y}$, ${\bf x}{\bf y}^{c}$, ${\bf y}{\bf x}$ and ${\bf y}{\bf x}^{c}$ are also tandem-free DNA strings with repeat-length $\ell$.

Proof

For given ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$ and $\mathscr{S}$ = $\{{\bf x},{\bf y},{\bf x}^{c},{\bf y}^{c}\}$, if the DNA strings ${\bf x}{\bf y}$, ${\bf x}{\bf y}^{c}$, ${\bf y}{\bf x}$ and ${\bf y}{\bf x}^{c}$ are all tandem-free DNA string with repeat-length $\ell$ then, from Proposition 7, all the DNA strings in the set $A$ = $\{{\bf x}{\bf y},{\bf x}{\bf y}^{c},{\bf x}^{c}{\bf y},{\bf x}^{c}{\bf y}^{c},{\bf y}{\bf x},{\bf y}{\bf x}^{c},{\bf y}^{c}{\bf x},{\bf y}^{c}{\bf x}^{c}\}$ are tandem-free DNA string with repeat-length $\ell$. Thus, for any binary string ${\bf a}$ = $(a_{1}\ a_{2}\ \ldots\ a_{n})\in\mathbb{Z}_{2}^{n}$, consider the encoded DNA string $\psi({\bf a})$ = ${\bf u}$ = $u_{1}u_{2}\ldots u_{n}$ in $\mathscr{S}^{n}$ that is obtained using $\ell$ order Non-Homopolymer map on ${\bf a}$, where

$$u_{i}=\begin{cases}\psi(a_{i},u_{i-1})&\mbox{ for }i=2,3,\ldots,n\mbox{ and }\\ f(a_{1})&\mbox{ for }i=1.\end{cases}$$

Now, for $i=1,2,\ldots,n-1$, $u_{i}u_{i+1}\in A$, and thus, $u_{i}u_{i+1}$ is tandem-free DNA string with repeat-length $\ell$ for each $i$. Hence, the encoded DNA string is tandem-free DNA string with repeat-length $\ell$.

The $GC$-weight of the DNA string that is obtained from Homopolymer map applied on any binary string is discussed in Lemma 19.

Lemma 19

For any integers $\ell$ ($\geq 1$) and $n$ ($\geq 1$), and given DNA strings ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$, the $GC$-weight of any DNA string ${\bf u}\in\psi(\mathbb{Z}_{2}^{n})$ is

$$w_{GC}({\bf u})=\left\{\begin{array}[]{ll}\frac{n}{2}(w_{GC}(u_{1})+w_{GC}(u_{2}))&\mbox{ if }n\mbox{ is even integer,}\\ w_{GC}(u_{1})+\frac{(n-1)}{2}\left(w_{GC}(u_{1})+w_{GC}(u_{2})\right)&\mbox{ if }n\mbox{ is odd integer.}\end{array}\right.$$

Proof

For any integers $\ell$ ($\geq 1$) and $n$ ($\geq 1$), if a binary string ${\bf a}$ = $(a_{1}\ a_{2}\ldots a_{n})\in\mathbb{Z}_{2}^{n}$ is encoded into the DNA string ${\bf u}$ = $u_{1}u_{2}\ldots u_{n}\in\psi(\mathbb{Z}_{2}^{n})$ using the $\ell$ order Non-Homopolymer map. Now, the $GC$-weight

$$\begin{split}w_{GC}({\bf u})&=\sum_{i=1}^{n}w_{GC}(u_{i})\\ &=\begin{cases}\sum_{j=1}^{n/2}(w_{GC}(u_{2j-1})+w_{GC}(u_{2j}))&\mbox{ if }n\mbox{ is even}\\ w_{GC}(u_{1})+\sum_{j=1}^{(n-1)/2}(w_{GC}(u_{2j})+w_{GC}(u_{2j+1}))&\mbox{ if }n\mbox{ is odd}\end{cases}\end{split}$$

But, from $\ell$ order Non-Homopolymer map, the $GC$-weight

$$w_{GC}(u_{i})=w_{GC}(u_{i+2})\mbox{ for }i=1,2,\ldots,n-2.$$

Therefore,

$$\begin{split}&w_{GC}(u_{2j-1})+w_{GC}(u_{2j})=w_{GC}(u_{1})+w_{GC}(u_{2})\mbox{ for }j=1,2,\ldots,n/2,\mbox{ and }\\ &w_{GC}(u_{2j})+w_{GC}(u_{2j+1})=w_{GC}(u_{2})+w_{GC}(u_{3})\mbox{ for }j=1,2,\ldots,(n-1)/2.\end{split}$$

Also, $w_{GC}(u_{1})$ = $w_{GC}(u_{3})$. Thus,

$$\begin{split}w_{GC}({\bf u})&=\begin{cases}\sum_{j=1}^{n/2}(w_{GC}(u_{1})+w_{GC}(u_{2}))&\mbox{ if }n\mbox{ is even}\\ w_{GC}(u_{1})+\sum_{j=1}^{(n-1)/2}(w_{GC}(u_{2})+w_{GC}(u_{3}))&\mbox{ if }n\mbox{ is odd}\end{cases}\\ &=\begin{cases}\sum_{j=1}^{n/2}(w_{GC}(u_{1})+w_{GC}(u_{2}))&\mbox{ if }n\mbox{ is even}\\ w_{GC}(u_{1})+\sum_{j=1}^{(n-1)/2}(w_{GC}(u_{1})+w_{GC}(u_{2}))&\mbox{ if }n\mbox{ is odd}\end{cases}\\ &=\begin{cases}\frac{n}{2}(w_{GC}(u_{1})+w_{GC}(u_{2}))&\mbox{ if }n\mbox{ is even}\\ w_{GC}(u_{1})+\frac{(n-1)}{2}(w_{GC}(u_{1})+w_{GC}(u_{2}))&\mbox{ if }n\mbox{ is odd}.\end{cases}\end{split}$$

It follows the result.

From Lemma 19, one can obtain Proposition 9, and further, Proposition 10 that ensures the $GC$-weight for encoded DNA codes.

Proposition 9

For any integers $\ell$ ($\geq 1$) and $n$ ($\geq 1$), and given DNA strings ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$, if $w_{GC}({\bf x})+w_{GC}({\bf y})$ = $\ell$ then the $GC$-weight of any DNA string ${\bf u}\in\psi(\mathbb{Z}_{2}^{n})$ is

$$w_{GC}({\bf u})=\left\{\begin{array}[]{ll}w_{GC}(u_{1})+\frac{(n-1)}{2}\ell&\mbox{ if }n\mbox{ is odd integer}\\ \frac{n}{2}\ell&\mbox{ if }n\mbox{ is even integer}.\end{array}\right.$$

Example 22

Example For $\ell$ = $2$, if ${\bf x}$ = $AT$ and ${\bf y}$ = $CG$ then $w_{GC}(\psi({\bf x}))$ = $0$, and $w_{GC}(\psi({\bf y}))$ = $2$.

• Now, for $n$ = $3$ (a odd integer), if ${\bf a}\in\mathbb{Z}_{2}^{3}$ then $\psi({\bf a})$ = ${\bf u}$ = $u_{1}u_{2}u_{3}$, where $u_{1},u_{3}\in\{AT,TA\}$ and $u_{2}\in\{GC,CG\}$. Therefore, $w_{GC}(u_{1})$ = $w_{GC}(\psi({\bf x}))$ = $0$. In this case, from Proposition 9, $w_{GC}(\psi({\bf a}))$ = $0+\frac{(3-1)}{2}\cdot 2$ = $2$, and it can be verified as follows.

  $$\begin{array}[]{c||c|c|c}\hline\cr{\bf a}&\psi({\bf a})&{\bf u}&w_{GC}({\bf u})\\ \hline\cr(0\ 0\ 0)&{\bf x}{\bf y}{\bf x}^{c}&ATCGTA&2\\ (0\ 0\ 1)&{\bf x}{\bf y}{\bf x}&ATCGAT&2\\ (0\ 1\ 0)&{\bf x}{\bf y}^{c}{\bf x}&ATGCAT&2\\ (0\ 1\ 1)&{\bf x}{\bf y}^{c}{\bf x}^{c}&ATGCTA&2\\ (1\ 0\ 0)&{\bf x}^{c}{\bf y}^{c}{\bf x}&TAGCAT&2\\ (1\ 0\ 1)&{\bf x}^{c}{\bf y}^{c}{\bf x}^{c}&TAGCTA&2\\ (1\ 1\ 0)&{\bf x}^{c}{\bf y}{\bf x}^{c}&TACGTA&2\\ (1\ 1\ 1)&{\bf x}^{c}{\bf y}{\bf x}&TACGAT&2\\ \hline\cr\end{array}$$

• Also, for $n$ = $4$ (an even integer), if ${\bf a}\in\mathbb{Z}_{2}^{4}$ then $\psi({\bf a})$ = ${\bf u}$ = $u_{1}u_{2}u_{3}u_{4}$, where $u_{1},u_{3}\in\{AT,TA\}$ and $u_{2},u_{4}\in\{GC,CG\}$. Therefore, $w_{GC}(u_{1})$ = $w_{GC}(\psi({\bf x}))$ = $0$. Again, from Proposition 9, $w_{GC}(\psi({\bf a}))$ = $0+\frac{4}{2}\cdot 2$ = $4$, and it can be verified as follows.

  $$\begin{array}[]{c||c|c|c}{\bf a}&\psi({\bf a})&{\bf u}&w_{GC}({\bf u})\\ \hline\cr(0\ 0\ 0\ 0)&{\bf x}{\bf y}{\bf x}^{c}{\bf y}^{c}&ATCGTAGC&4\\ (0\ 0\ 0\ 1)&{\bf x}{\bf y}{\bf x}^{c}{\bf y}&ATCGTACG&4\\ (0\ 0\ 1\ 0)&{\bf x}{\bf y}{\bf x}{\bf y}&ATCGATCG&4\\ (0\ 0\ 1\ 1)&{\bf x}{\bf y}{\bf x}{\bf y}^{c}&ATCGATGC&4\\ (0\ 1\ 0\ 0)&{\bf x}{\bf y}^{c}{\bf x}{\bf y}&ATGCATCG&4\\ (0\ 1\ 0\ 1)&{\bf x}{\bf y}^{c}{\bf x}{\bf y}^{c}&ATGCATGC&4\\ (0\ 1\ 1\ 0)&{\bf x}{\bf y}^{c}{\bf x}^{c}{\bf y}^{c}&ATGCTAGC&4\\ (0\ 1\ 1\ 1)&{\bf x}{\bf y}^{c}{\bf x}^{c}{\bf y}&ATGCTACG&4\\ (1\ 0\ 0\ 0)&{\bf x}^{c}{\bf y}^{c}{\bf x}{\bf y}&TAGCATCG&4\\ (1\ 0\ 0\ 1)&{\bf x}^{c}{\bf y}^{c}{\bf x}{\bf y}^{c}&TAGCATGC&4\\ (1\ 0\ 1\ 0)&{\bf x}^{c}{\bf y}^{c}{\bf x}^{c}{\bf y}^{c}&TAGCTAGC&4\\ (1\ 0\ 1\ 1)&{\bf x}^{c}{\bf y}^{c}{\bf x}^{c}{\bf y}&TAGCTACG&4\\ (1\ 1\ 0\ 0)&{\bf x}^{c}{\bf y}{\bf x}^{c}{\bf y}^{c}&TACGTAGC&4\\ (1\ 1\ 0\ 1)&{\bf x}^{c}{\bf y}{\bf x}^{c}{\bf y}&TACGTACG&4\\ (1\ 1\ 1\ 0)&{\bf x}^{c}{\bf y}{\bf x}{\bf y}&TACGATCG&4\\ (1\ 1\ 1\ 1)&{\bf x}^{c}{\bf y}{\bf x}{\bf y}^{c}&TACGATGC&4\end{array}$$

Proposition 10

For any integers $\ell$ ($\geq 1$) and $n$ ($\geq 1$), and given DNA strings ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$, the $GC$-weight of any DNA string ${\bf u}\in\psi(\mathbb{Z}_{2}^{n})$ is

$$w_{GC}({\bf u})=\left\{\begin{array}[]{ll}\lfloor n\ell/2\rfloor&\mbox{ if }w_{GC}({\bf x})=\lfloor\ell/2\rfloor\mbox{ and }w_{GC}({\bf y})=\lceil\ell/2\rceil,\\ \lceil n\ell/2\rceil&\mbox{ if }w_{GC}({\bf x})=\lceil\ell/2\rceil\mbox{ and }w_{GC}({\bf y})=\lfloor\ell/2\rfloor.\end{array}\right.$$

Example 23

Example For $\ell$ = $3$ and $n$ = $3$, if ${\bf x},{\bf y}\in\Sigma_{DNA}^{3}$ and ${\bf a}\in\mathbb{Z}_{2}^{3}$ then consider $\psi({\bf a})$ = ${\bf u}$ = $u_{1}u_{2}u_{3}$, where $u_{1},u_{3}\in\{{\bf x}^{c},{\bf x}\}$ and $u_{2}\in\{{\bf y},^{c},{\bf y}\}$. Then one can observe the following.

• If ${\bf x}$ = $ACA$ and ${\bf y}$ = $CTC$ then $w_{GC}(\psi({\bf x}))$ = $\lfloor 3/2\rfloor$ = $1$, and $w_{GC}(\psi({\bf y}))$ = $\lceil 3/2\rceil$ = $2$. In this case, from Proposition 10, $w_{GC}({\bf u})$ = $\lfloor 3\cdot 3/2\rfloor$ = $4$, and it can be verified as follows.

  $$\begin{array}[]{c||c|c|c}\hline\cr{\bf a}&\psi({\bf a})&{\bf u}&w_{GC}({\bf u})\\ \hline\cr(0\ 0\ 0)&{\bf x}{\bf y}{\bf x}^{c}&ACACTCTGT&4\\ (0\ 0\ 1)&{\bf x}{\bf y}{\bf x}&ACACTCACA&4\\ (0\ 1\ 0)&{\bf x}{\bf y}^{c}{\bf x}&ACAGAGACA&4\\ (0\ 1\ 1)&{\bf x}{\bf y}^{c}{\bf x}^{c}&ACAGAGTGT&4\\ (1\ 0\ 0)&{\bf x}^{c}{\bf y}^{c}{\bf x}&TGTGAGACA&4\\ (1\ 0\ 1)&{\bf x}^{c}{\bf y}^{c}{\bf x}^{c}&TGTGAGTGT&4\\ (1\ 1\ 0)&{\bf x}^{c}{\bf y}{\bf x}^{c}&TGTCTCTGT&4\\ (1\ 1\ 1)&{\bf x}^{c}{\bf y}{\bf x}&TGTCTCACA&4\\ \hline\cr\end{array}$$

• Also, if ${\bf x}$ = $CGA$ and ${\bf y}$ = $CAT$ then $w_{GC}(\psi({\bf x}))$ = $\lceil 3/2\rceil$ = $2$, and $w_{GC}(\psi({\bf y}))$ = $\lfloor 3/2\rfloor$ = $1$. In this case, from Proposition 10, $w_{GC}({\bf u})$ = $\lceil 3\cdot 3/2\rceil$ = $5$, and it can be verified as follows.

  $$\begin{array}[]{c||c|c|c}{\bf a}&\psi({\bf a})&{\bf u}&w_{GC}({\bf u})\\ \hline\cr(0\ 0\ 0)&{\bf x}{\bf y}{\bf x}^{c}&CGACATGCT&5\\ (0\ 0\ 1)&{\bf x}{\bf y}{\bf x}&CGACATCGA&5\\ (0\ 1\ 0)&{\bf x}{\bf y}^{c}{\bf x}&CGAGTACGA&5\\ (0\ 1\ 1)&{\bf x}{\bf y}^{c}{\bf x}^{c}&CGAGTAGCT&5\\ (1\ 0\ 0)&{\bf x}^{c}{\bf y}^{c}{\bf x}&GCTGTACGA&5\\ (1\ 0\ 1)&{\bf x}^{c}{\bf y}^{c}{\bf x}^{c}&GCTGTAGCT&5\\ (1\ 1\ 0)&{\bf x}^{c}{\bf y}{\bf x}^{c}&GCTCATGCT&5\\ (1\ 1\ 1)&{\bf x}^{c}{\bf y}{\bf x}&GCTCATCGA&5\\ \hline\cr\end{array}$$

5.2 The Non-Homopolymer Distance and Properties

Now, we define a distance as given in Definition 8 for any alphabet of size $q$ such that the distance is equal to the Hamming distance in the respective DNA codes for a special case of binary alphabet.

Definition 8

For any integer $n$ ($>1$) and an alphabet $\mathcal{A}_{q}$ ($q\leq 2$), consider ${\bf a}$ = $(a_{1}\ a_{2}\ldots a_{n})$ and ${\bf b}$ = $(b_{1}\ b_{2}\ldots b_{n})$ in $\mathcal{A}_{q}^{n}$. Now, for the support set

$$S=\{i:i=1,2,\ldots,n\mbox{ and }a_{i}\neq b_{i}\},$$

and the set

$$T=\left\{\begin{array}[]{ll}S\cup\{n+1\}&\mbox{ if the size of the set }S\mbox{ is odd},\\ S&\mbox{ if the size of the set }S\mbox{ is even},\end{array}\right.$$

if the extended support set $T$ is a nonempty set then consider $T$ = $\{t_{1},t_{2},\ldots,t_{|T|}\}$ such that $t_{j}<t_{j+1}$ for $j=1,2,\ldots,|T|-1$, where $|T|$ represents the size of the set $T$. For any integer $\ell$ ($\geq 1$), define a map

$$\begin{split}&d_{NHo}:\mathcal{A}_{q}^{n}\times\mathcal{A}_{q}^{n}\rightarrow\mathbb{R}\mbox{ such that }\\ &d_{NHo}({\bf a},{\bf b})=\left\{\begin{array}[]{ll}\ell\sum_{j=1}^{|T|/2}(t_{2j}-t_{2j-1})&\mbox{ if }|T|>0,\\ 0&\mbox{ if }|T|=0.\end{array}\right.\end{split}$$

Example 24

Example For $n=5$ and $\ell=3$, consider ${\bf a}=(1\ 0\ 0\ 0\ 0)$ and ${\bf b}=(1\ 1\ 1\ 0\ 1)$ in $\mathbb{Z}_{2}^{5}$. Then the support set $S$ = $\{2,3,5\}$, and thus, the extended support set $T$ = $\{2,3,5,6\}$. Therefore,

$$\begin{split}d_{NHo}({\bf a},{\bf b})&=3\left((3-2)+(6-5)\right)\\ &=6.\end{split}$$

From Definition 8, one can observe Remark 2 and Remark 3 as follows.

Remark 2

For ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$ and any ${\bf a}\in\mathbb{Z}_{2}^{n}$, if $\psi({\bf a})$ = ${\bf u}$ = $u_{1}u_{2}\ldots u_{n}$ in $\psi(\mathbb{Z}_{2}^{n})$ then

$$u_{i}\in\begin{cases}\{{\bf x}^{c},{\bf x}\}&\mbox{ if }i\mbox{ is odd, and}\\ \{{\bf y},^{c},{\bf y}\}&\mbox{ if }i\mbox{ is even.}\end{cases}$$

Remark 3

For ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$ and any ${\bf a},{\bf b}\in\mathbb{Z}_{2}^{n}$, consider $\psi({\bf a})$ = ${\bf u}$ = $u_{1}u_{2}\ldots u_{n}$ and $\psi({\bf b})$ = ${\bf v}$ = $v_{1}v_{2}\ldots v_{n}$ in $\psi(\mathbb{Z}_{2}^{n})$ with support set $S$ = $\{t_{1},t_{2},\ldots,t_{s}\}$ of size $s$ such that $1\leq t_{1}<t_{2}<\ldots<t_{s}\leq n$. Then,

• if $t_{1}>1$ then the DNA sub-strings $u_{1}u_{2}\ldots u_{t_{1}-1}$ and $v_{1}v_{2}\ldots v_{t_{1}-1}$ exist, and

  $$u_{1}u_{2}\ldots u_{t_{1}-1}=v_{1}v_{2}\ldots v_{t_{1}-1},$$

• for any odd integer $i$, if $t_{i}$ and $t_{i+1}$ are in the extended support set $T$ then the DNA sub-strings $u_{t_{i}}u_{t_{i}+1}\ldots u_{t_{i+1}-1}$ and $v_{t_{i}}v_{t_{i}+1}\ldots v_{t_{i+1}-1}$ exist, and

  $$u_{t_{i}}u_{t_{i}+1}\ldots u_{t_{i+1}-1}=v_{t_{i}}^{c}v_{t_{i}+1}^{c}\ldots v_{t_{i+1}-1}^{c},$$

• for any even integer $i$, if $t_{i}$ and $t_{i+1}$ are in the extended support set $T$ then the DNA sub-strings $u_{t_{i}}u_{t_{i}+1}\ldots u_{t_{i+1}-1}$ and $v_{t_{i}}v_{t_{i}+1}\ldots v_{t_{i+1}-1}$ exist, and

  $$u_{t_{i}}u_{t_{i}+1}\ldots u_{t_{i+1}-1}=v_{t_{i}}v_{t_{i}+1}\ldots v_{t_{i+1}-1},and$$

• if $t_{s}\leq n$ then the DNA sub-strings $u_{s}u_{s+1}\ldots u_{n}$ and $v_{s}v_{s+1}\ldots v_{n}$ exist, and

  $$u_{s}u_{s+1}\ldots u_{n}=\begin{cases}v_{s}v_{s+1}\ldots v_{n}&\mbox{ if }s\mbox{ is even, and}\\ v_{s}^{c}v_{s+1}^{c}\ldots v_{n}^{c}&\mbox{ if }s\mbox{ is odd.}\end{cases}$$

We have shown in Lemma 21 that the real map as given in Definition 8 is a distance. For that first we need a result that is given in Lemma 20.

Lemma 20

For any integer $\ell$ ($\geq 1$), any ${\bf a},{\bf b}\in\mathcal{A}_{q}^{n}$ and any $a,b\in\mathcal{A}_{q}$,

$$d_{NHo}(({\bf a}\ a),({\bf b}\ b))=\begin{cases}d_{NHo}({\bf a},{\bf b})&\mbox{ if }a=b\mbox{ and }|S|\mbox{ is even,}\\ \ell+d_{NHo}({\bf a},{\bf b})&\mbox{ if }a=b\mbox{ and }|S|\mbox{ is odd,}\\ \ell+d_{NHo}({\bf a},{\bf b})&\mbox{ if }a\neq b\mbox{ and }|S|\mbox{ is even, and}\\ d_{NHo}({\bf a},{\bf b})&\mbox{ if }a\neq b\mbox{ and }|S|\mbox{ is odd.}\end{cases}$$

Proof

For any ${\bf a}$ and ${\bf b}$ in $\mathcal{A}_{q}^{n}$, the support set and extended support set are $S$ and $T$. For any $a,b\in\mathcal{A}_{q}$, consider $({\bf a}\ a)$ and $({\bf b}\ b)$ in $\mathcal{A}_{q}^{n+1}$ along with the support set $S^{*}$ and extended support set $T^{*}$. Then, from Definition 8, the support set

$$S^{*}=\begin{cases}S&\mbox{ if }a=b,\\ S\cup\{|S|+1\}&\mbox{ if }a\neq b,\end{cases}$$

and the extended support set

$$T^{*}=\begin{cases}S&\mbox{ if }a=b\mbox{ and }|S|\mbox{ is even,}\\ S\cup\{|S|+2\}&\mbox{ if }a=b\mbox{ and }|S|\mbox{ is odd,}\\ S\cup\{|S|+1,|S|+2\}&\mbox{ if }a\neq b\mbox{ and }|S|\mbox{ is even, and}\\ S\cup\{|S|+1\}&\mbox{ if }a\neq b\mbox{ and }|S|\mbox{ is odd.}\end{cases}$$

Therefore, from Definition 8,

$$d_{NHo}(({\bf a}\ a),({\bf b}\ b))=\begin{cases}d_{NHo}({\bf a},{\bf b})&\mbox{ if }a=b\mbox{ and }|S|\mbox{ is even,}\\ \ell+d_{NHo}({\bf a},{\bf b})&\mbox{ if }a=b\mbox{ and }|S|\mbox{ is odd,}\\ \ell+d_{NHo}({\bf a},{\bf b})&\mbox{ if }a\neq b\mbox{ and }|S|\mbox{ is even, and}\\ d_{NHo}({\bf a},{\bf b})&\mbox{ if }a\neq b\mbox{ and }|S|\mbox{ is odd.}\end{cases}$$

It follows the result.

Lemma 21

The map $d_{NHo}:\mathcal{A}_{q}\times\mathcal{A}_{q}\rightarrow\mathbb{R}$, as given in Definition 8, is a distance.

Proof

A real map is called distance if the map follows non-negative property, identity of indiscernibles property, symmetry property and triangular property. For the real map $d_{NHo}$, one can observe the following.

Non-Negative Property:

For any integer $\ell$ ($\geq 1$) and any ${\bf a},{\bf b}\in\mathcal{A}_{q}^{n}$, consider the nonempty extended support set $T$ = $\{t_{1},t_{2},\ldots,t_{|T|}\}$, where $t_{j}<t_{j+1}$ for $j=1,2,\ldots,|T|-1$. Then,

$$\begin{split}&t_{2j}-t_{2j-1}>0\mbox{ for }j=1,2,\ldots,|T|/2\\ \Rightarrow\hskip 2.84544pt&\ell\sum_{j=1}^{|T|/2}(t_{2j}-t_{2j-1})>0\\ \Rightarrow\hskip 2.84544pt&d_{NHo}({\bf a},{\bf b})>0\mbox{ for any }{\bf a},{\bf b}\in\mathcal{A}_{q}^{n}.\\ \end{split}$$

Now, if the empty extended support set is empty, $i.e.$, $T$ = $\emptyset$ then the proof for the non-negative property is trivial.

Identity of Indiscernibles:

For any ${\bf a}$ = $(a_{1}\ a_{2}\ \ldots\ a_{n})$ and ${\bf b}$ = $(b_{1}\ b_{2}\ \ldots\ b_{n})$ in $\mathcal{A}_{q}^{n}$, the distance

$$\begin{split}&d_{NHo}({\bf a},{\bf b})=0\\ \Leftrightarrow\hskip 2.84544pt&T=\emptyset\\ \Leftrightarrow\hskip 2.84544pt&S=\emptyset\\ \Leftrightarrow\hskip 2.84544pt&a_{i}=b_{i}\mbox{ for }i=1,2,\ldots,n\\ \Leftrightarrow\hskip 2.84544pt&{\bf a}={\bf b}.\end{split}$$

Symmetry Property:

For any ${\bf a},{\bf b}\in\mathcal{A}_{q}^{n}$, the support set for the both $d_{NHo}({\bf a},{\bf b})$ and $d_{NHo}({\bf b},{\bf a})$ are the same, and thus, $d_{NHo}({\bf a},{\bf b})$ = $d_{NHo}({\bf b},{\bf a})$.

Triangular Property:

Using Mathematical Induction over $n$, we have shown the triangle property for $d_{NHo}$.
Base Case: For $n=1$, it is easy to verify that the map $d_{NHo}$ holds Triangle property $d_{NHo}(a,b)\leq d_{NHo}(a,c)+d_{NHo}(c,b)$ for any $a,b,c\in\mathcal{A}_{q}$.
Hypothesis: For $n=k$ and any ${\bf a},{\bf b},{\bf c}\in\mathcal{A}_{q}^{k}$, we assume that the map $d_{NHo}$ holds Triangle property, $i.e.$,

$$d_{NHo}({\bf a},{\bf b})\leq d_{NHo}({\bf a},{\bf c})+d_{NHo}({\bf c},{\bf b}).$$

Inductive Step: For any ${\bf a},{\bf b},{\bf c}\in\mathcal{A}_{q}^{k}$ and any $a,b\in\mathcal{A}_{q}$, consider support sets $S_{{\bf a},{\bf b}}$, $S_{{\bf a},{\bf c}}$ and $S_{{\bf c},{\bf b}}$ for $d_{NHo}({\bf a},{\bf b})$, $d_{NHo}({\bf a},{\bf c})$ and $d_{NHo}({\bf c},{\bf b})$, respectively. Now, from Lemma 20,
$d_{NHo}(({\bf a}\ a),({\bf b}\ b))$ =

$$\begin{cases}d_{NHo}({\bf a},{\bf b})&\mbox{ if }a=b\mbox{ and }|S_{{\bf a},{\bf b}}|\mbox{ is even,}\\ \ell+d_{NHo}({\bf a},{\bf b})&\mbox{ if }a=b\mbox{ and }|S_{{\bf a},{\bf b}}|\mbox{ is odd,}\\ \ell+d_{NHo}({\bf a},{\bf b})&\mbox{ if }a\neq b\mbox{ and }|S_{{\bf a},{\bf b}}|\mbox{ is even,}\\ d_{NHo}({\bf a},{\bf b})&\mbox{ if }a\neq b\mbox{ and }|S_{{\bf a},{\bf b}}|\mbox{ is odd,}\end{cases}$$

$d_{NHo}(({\bf a}\ a),({\bf c}\ c))$ =

$$\begin{cases}d_{NHo}({\bf a},{\bf c})&\mbox{ if }a=c\mbox{ and }|S_{{\bf a},{\bf c}}|\mbox{ is even,}\\ \ell+d_{NHo}({\bf a},{\bf c})&\mbox{ if }a=c\mbox{ and }|S_{{\bf a},{\bf c}}|\mbox{ is odd,}\\ \ell+d_{NHo}({\bf a},{\bf c})&\mbox{ if }a\neq c\mbox{ and }|S_{{\bf a},{\bf c}}|\mbox{ is even,}\\ d_{NHo}({\bf a},{\bf c})&\mbox{ if }a\neq c\mbox{ and }|S_{{\bf a},{\bf c}}|\mbox{ is odd,}\end{cases}$$

and $d_{NHo}(({\bf c}\ c),({\bf b}\ b))$ =

$$\begin{cases}d_{NHo}({\bf c},{\bf b})&\mbox{ if }c=b\mbox{ and }|S_{{\bf c},{\bf b}}|\mbox{ is even,}\\ \ell+d_{NHo}({\bf c},{\bf b})&\mbox{ if }c=b\mbox{ and }|S_{{\bf c},{\bf b}}|\mbox{ is odd,}\\ \ell+d_{NHo}({\bf c},{\bf b})&\mbox{ if }c\neq b\mbox{ and }|S_{{\bf c},{\bf b}}|\mbox{ is even, and}\\ d_{NHo}({\bf c},{\bf b})&\mbox{ if }c\neq b\mbox{ and }|S_{{\bf c},{\bf b}}|\mbox{ is odd.}\end{cases}$$

Now, for various cases, one can easily obtain that

$$d_{NHo}({\bf a},{\bf b})\leq d_{NHo}({\bf a},{\bf c})+d_{NHo}({\bf c},{\bf b}).$$

So, the map $d_{NHo}$ follows the triangle property for $n$ = $k+1$. Thus, from Mathematical Induction, $d_{NHo}$ follows the Triangle property

Hence, from the distance definition, the map given in Definition 8 is a distance.

For any code $\mathscr{C}\subseteq\mathcal{A}_{q}^{n}$, the minimum Non-Homopolymer distance is

$$d_{NHo}=\min\{d_{NHo}({\bf a},{\bf b}):{\bf a},{\bf b}\in\mathscr{C}\mbox{ and }{\bf a}\neq{\bf b}\}.$$

In Remark 4, we have obtained a bound on the minimum Non-Homopolymer distance as follows.

Remark 4

For any ${\bf a},{\bf b}\in\mathcal{A}_{q}^{n}$, from Definition 8, one can observe that the size of the support set is the Hamming distance $H({\bf a},{\bf a})$. Therefore, the Non-Homopolymer distance $d_{NHo}({\bf x},{\bf y})\geq\lceil H({\bf x},{\bf y})/2\rceil$, and thus, for any code with the minimum Non-Homopolymer distance $d_{NHo}$ and the minimum Hamming distance $d_{H}$,

$$\lceil d_{H}/2\rceil\leq d_{NHo}.$$

Now, bounds on various Hamming distances are calculated in Theorem 5.1 and Proposition 11 that helps to study the R and RC constraints in DNA codes obtained from binary codes.

Theorem 5.1

For any given integers $\ell$ and $n$ ($\ell,n\geq 1$), consider ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$. Then, for DNA strings ${\bf u},{\bf v}\in\psi(\mathbb{Z}_{2}^{n})$, the Hamming distance

$$H({\bf u},{\bf v}^{r})\geq\left\{\begin{array}[]{ll}n\min\{H({\bf x},{\bf y}^{r}),H({\bf x},{\bf y}^{rc})\},&\mbox{ if }n\mbox{ is even,}\\ \min\left\{H({\bf x},{\bf x}^{r}),H({\bf y},{\bf y}^{r}),H({\bf x},{\bf x}^{rc}),H({\bf y},{\bf y}^{rc})\right\},&\mbox{ if }n\mbox{ is odd. }\end{array}\right.$$

Proof

For ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$, consider binary strings ${\bf a},{\bf b}\in(\mathbb{Z}_{2}^{n})$ of length $n$ and these strings are encoded into DNA strings $\psi({\bf a})$ = ${\bf u}$ = $u_{1}u_{2}\ldots u_{n}$ and $\psi({\bf b})$ = ${\bf v}$ = $v_{1}v_{2}\ldots v_{n}$ in $\psi(\mathbb{Z}_{2}^{n})$ using $\ell$ order Non-Homopolymer Map, where $u_{2i},v_{2i}\in\{{\bf y}^{c},{\bf y}\}$ and $u_{2i-1},v_{2i-1}\in\{{\bf x}^{c},{\bf x}\}$ for $i=1,2,\ldots,n$. Consider

$$H({\bf u},{\bf v}^{r})=\sum_{j=1}^{n}H(u_{j},v^{r}_{n-j+1}).$$

Now, there are two cases as follows.

Odd $n$:

In this case, $j$ is even (odd) if and only if $n-j+1$ is even (odd). Thus, if $j$ is even then $u_{j},v_{n-j+1}\in\{{\bf y}^{c},{\bf y}\}$, and if $j$ is odd then $u_{j},v_{n-j+1}\in\{{\bf x}^{c},{\bf x}\}$. So,

$$H(u_{j},v^{r}_{n-j+1})\geq\min\{H({\bf x},{\bf x}^{r}),H({\bf y},{\bf y}^{r}),H({\bf x},{\bf x}^{rc}),H({\bf y},{\bf y}^{rc})\}.$$

Even $n$:

In this case, $j$ is even (odd) if and only if $n-j+1$ is odd (even). Thus, if $j$ is even then $u_{j}\in\{{\bf y},^{c},{\bf y}\}$ and $v_{n-j+1}\in\{{\bf x}^{c},{\bf x}\}$. And, if $j$ is odd then $u_{j}\in\{{\bf x}^{c},{\bf x}\}$ and $v_{n-j+1}\in\{{\bf y}^{c},{\bf y}\}$. Thus,

$$H(u_{j},v_{n-j+1}^{r})\geq\min\{H({\bf x},{\bf y}^{r}),H({\bf x},{\bf y}^{rc})\}.$$

Hence, the result follows for any integer $n$.

Proposition 11

For any given integers $\ell$ and $n$ ($\ell,n\geq 1$), consider ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$. Then, for any DNA strings ${\bf u},{\bf v}\in\psi(\mathbb{Z}_{2}^{n})$, the Hamming distance

$$H({\bf u},{\bf v}^{rc})\geq\left\{\begin{array}[]{ll}n\min\{H({\bf x},{\bf y}^{r}),H({\bf x},{\bf y}^{rc})\},&\mbox{ if }n\mbox{ is even,}\\ \min\left\{H({\bf x},{\bf x}^{r}),H({\bf y},{\bf y}^{r}),H({\bf x},{\bf x}^{rc}),H({\bf y},{\bf y}^{rc})\right\},&\mbox{ if }n\mbox{ is odd. }\end{array}\right.$$

In Theorem 5.2, a condition on DNA blocks are obtained that ensures the R constraint for the encoded DNA code.

Theorem 5.2

For any even integer $n$ and an integer $\ell$ ($\ell,n\geq 1$), if ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$ such that $H({\bf x}^{rc},{\bf y})$ = $H({\bf x}^{r},{\bf y})=\ell$ then, the DNA codes obtained from $\ell$ order Non-Homopolymer map satisfy the R and RC constraints.

Proof

If $H({\bf x}^{rc},{\bf y})$ = $H({\bf x}^{r},{\bf y})=\ell$ then, from Theorem 5.1,

$$\begin{split}H({\bf u}^{r},{\bf v})&\geq n\min\left\{H({\bf x}^{r},{\bf y}),H({\bf x}^{rc},{\bf y})\right\}\\ &=n\ell.\end{split}$$

Similarly from Proposition 11,

$$\begin{split}H({\bf u}^{rc},{\bf v})&\geq n\min\left\{H({\bf x}^{r},{\bf y}),H({\bf x}^{rc},{\bf y})\right\}\\ &=n\ell.\end{split}$$

But the length of DNA string ${\bf u}$ and DNA string ${\bf v}$ are the same and equal to $n\ell$. Thus, $d_{H}\leq H({\bf u},{\bf v})\leq n\ell$. Therefore, $H({\bf u}^{r},{\bf v})\geq d_{H}$ and $H({\bf u}^{rc},{\bf v})\geq d_{H}$ for any DNA code obtained from $\ell$ order Non-Homopolymer map, where $H({\bf x}^{rc},{\bf y})$ = $H({\bf x}^{r},{\bf y})=\ell$.

Example 25

Example For $n=4$, $\ell$ = $2$, ${\bf x}$ = $AT$ and ${\bf y}$ = $CG$,

$$\begin{array}[]{ccccc}\begin{array}[]{c|}\mathbb{Z}_{2}^{4}\\ \hline\cr(0\ 0\ 0\ 0)\\ (0\ 0\ 0\ 1)\\ (0\ 0\ 1\ 0)\\ (0\ 0\ 1\ 1)\\ (0\ 1\ 0\ 0)\\ (0\ 1\ 0\ 1)\\ (0\ 1\ 1\ 0)\\ (0\ 1\ 1\ 1)\\ (1\ 0\ 0\ 0)\\ (1\ 0\ 0\ 1)\\ (1\ 0\ 1\ 0)\\ (1\ 0\ 1\ 1)\\ (1\ 1\ 0\ 0)\\ (1\ 1\ 0\ 1)\\ (1\ 1\ 1\ 0)\\ (1\ 1\ 1\ 1)\end{array}&\begin{array}[]{l}\psi(\mathbb{Z}_{2}^{4})\\ \hline\cr{\bf x}{\bf y}{\bf x}^{c}{\bf y}^{c}\\ {\bf x}{\bf y}{\bf x}^{c}{\bf y}\\ {\bf x}{\bf y}{\bf x}{\bf y}\\ {\bf x}{\bf y}{\bf x}{\bf y}^{c}\\ {\bf x}{\bf y}^{c}{\bf x}{\bf y}\\ {\bf x}{\bf y}^{c}{\bf x}{\bf y}^{c}\\ {\bf x}{\bf y}^{c}{\bf x}^{c}{\bf y}^{c}\\ {\bf x}{\bf y}^{c}{\bf x}^{c}{\bf y}\\ {\bf x}^{c}{\bf y}^{c}{\bf x}{\bf y}\\ {\bf x}^{c}{\bf y}^{c}{\bf x}{\bf y}^{c}\\ {\bf x}^{c}{\bf y}^{c}{\bf x}^{c}{\bf y}^{c}\\ {\bf x}^{c}{\bf y}^{c}{\bf x}^{c}{\bf y}\\ {\bf x}^{c}{\bf y}{\bf x}^{c}{\bf y}^{c}\\ {\bf x}^{c}{\bf y}{\bf x}^{c}{\bf y}\\ {\bf x}^{c}{\bf y}{\bf x}{\bf y}\\ {\bf x}^{c}{\bf y}{\bf x}{\bf y}^{c}\end{array}&\begin{array}[]{c}{\bf u}\\ \hline\cr ATCGTAGC\\ ATCGTACG\\ ATCGATCG\\ ATCGATGC\\ ATGCATCG\\ ATGCATGC\\ ATGCTAGC\\ ATGCTACG\\ TAGCATCG\\ TAGCATGC\\ TAGCTAGC\\ TAGCTACG\\ TACGTAGC\\ TACGTACG\\ TACGATCG\\ TACGATGC\end{array}&\begin{array}[]{c}{\bf u}^{r}\\ \hline\cr CGATGCTA\\ GCATGCTA\\ GCTAGCTA\\ CGTAGCTA\\ GCTACGTA\\ CGTACGTA\\ CGATCGTA\\ GCATCGTA\\ GCTACGAT\\ CGTACGAT\\ CGATCGAT\\ GCATCGAT\\ CGATGCAT\\ GCATGCAT\\ GCTAGCAT\\ CGTAGCAT\end{array}&\begin{array}[]{c}{\bf u}^{rc}\\ \hline\cr GCTACGAT\\ CGTACGAT\\ CGATCGAT\\ GCATCGAT\\ CGATGCAT\\ GCATGCAT\\ GCTAGCAT\\ CGTAGCAT\\ CGATGCTA\\ GCATGCTA\\ GCTAGCTA\\ CGTAGCTA\\ GCTACGTA\\ CGTACGTA\\ CGATCGTA\\ GCATCGTA\end{array}\end{array}$$

One can easily observe that, for any ${\bf a},{\bf b}\in\mathbb{Z}_{2}^{4}$,

$$\begin{split}&H(\psi({\bf a})^{r},\psi({\bf b}))=8\geq H(\psi({\bf a}),\psi({\bf b}))\\ &H(\psi({\bf a})^{rc},\psi({\bf b}))=8\geq H(\psi({\bf a}),\psi({\bf b}))\\ &d_{NHo}({\bf a},{\bf b})=H(\psi({\bf a}),\psi({\bf b}))\end{split}$$

Therefore, for any binary code $\mathscr{C}\subseteq\mathbb{Z}_{2}^{4}$, the DNA code $\psi(\mathscr{C})$ satisfies R and RC constraints.

Now, the isometry is established between DNA codes and binary codes in the Theorem 5.3.

Theorem 5.3

For any integers $\ell$ and $n$ ($\ell,n\geq 1$), the map

$$\psi:(\mathbb{Z}_{2}^{n},d_{NHo})\rightarrow(\psi(\mathbb{Z}_{2}^{n}),d_{H})$$

is an isometry.

Proof

The result is proved using Mathematical Induction on the string length $n$.

Base case:

For $n=1$, consider $a,b\in\mathbb{Z}_{2}$. Now, one can computationally verify that

$$d_{NHo}(a,b)=H(\psi(a),\psi(b)).$$

Hypothesis:

For $n=m$ and ${\bf a},{\bf b}\in\mathbb{Z}_{2}^{m}$, assume

$$d_{NHo}({\bf a},{\bf b})=H(\psi({\bf a}),\psi({\bf b})).$$

Inductive Step:

Consider binary strings ${\bf a}$ = $(a_{1}\ a_{2}\ldots a_{m})$ and ${\bf b}$ = $(b_{1}\ b_{2}\ldots b_{m})$ of length $m$ with the support set $S$ and the extended support set $T$. The binary strings are encoded into DNA strings $\psi({\bf a})$ = ${\bf u}$ = $u_{1}u_{2}\ldots u_{m}$ and $\psi({\bf b})$ = ${\bf v}$ = $v_{1}v_{2}\ldots v_{m}$ using $\ell$ order Non-Homopolymer map for ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$. For $n=m+1$, consider the binary strings ${\bf a}^{*}$ = $({\bf a}\ a_{m+1})$ = $(a_{1}\ a_{2}\ldots a_{m}\ a_{m+1})$ and ${\bf b}^{*}$ = $({\bf b}\ b_{m+1})$ = $(b_{1}\ b_{2}\ldots b_{m}\ b_{m+1})$ of length $m+1$ with the support set $S^{*}$ and the extended support set $T^{*}$, where $a_{m+1},b_{m+1}\in\mathbb{Z}_{2}$. For the binary strings ${\bf a}^{*}$ and ${\bf b}^{*}$, consider the DNA strings $\psi({\bf a}^{*})$ = ${\bf u}^{*}$ = ${\bf u}u_{m+1}$ = $u_{1}u_{2}\ldots u_{m}u_{m+1}$ and $\psi({\bf b}^{*})$ = ${\bf v}^{*}$ = ${\bf v}v_{m+1}$ = $v_{1}v_{2}\ldots v_{m}v_{m+1}$, where $u_{m+1},v_{m+1}\in\{{\bf x},{\bf x}^{c},{\bf y},{\bf y}^{c}\}$. Now, for the binary strings ${\bf a}^{*}$ and ${\bf b}^{*}$, the support set and extended support set are

$$S^{*}=\begin{cases}S&\mbox{ if }a_{m}=b_{m},\\ S\cup\{|S|+1\}&\mbox{ if }a_{m}\neq b_{m},\end{cases}$$

and

$$T^{*}=\begin{cases}S&\mbox{ if }a=b\mbox{ and }|S|\mbox{ is even,}\\ S\cup\{|S|+2\}&\mbox{ if }a=b\mbox{ and }|S|\mbox{ is odd,}\\ S\cup\{|S|+1,|S|+2\}&\mbox{ if }a\neq b\mbox{ and }|S|\mbox{ is even, and}\\ S\cup\{|S|+1\}&\mbox{ if }a\neq b\mbox{ and }|S|\mbox{ is odd.}\end{cases}$$

Now, from Remark 2 and Remark 3, one can get $d_{NHo}({\bf a}^{*},{\bf b}^{*})$ = $H(\psi({\bf a}^{*}),\psi({\bf b}^{*}))$ for various cases. It is interesting task to identify those four cases and verify $d_{NHo}({\bf a}^{*},{\bf b}^{*})$ = $H(\psi({\bf a}^{*}),\psi({\bf b}^{*}))$ for all the cases. Now, from the verification, the hypothesis holds for $n$ = $m+1$.

Hence, the result follows from Mathematical Induction on the parameter $n$.

Example 26

Example For each ${\bf a},{\bf b}\in\mathbb{Z}_{2}^{3}$ and given integer $\ell$ ($\geq 1$), the distance $d_{NHo}({\bf a},{\bf b})$ is calculated as following.

$$\begin{array}[]{c|cccccccc}d_{NHo}({\bf a},{\bf b})&(0\ 0\ 0)&(0\ 0\ 1)&(0\ 1\ 0)&(0\ 1\ 1)&(1\ 0\ 0)&(1\ 0\ 1)&(1\ 1\ 0)&(1\ 1\ 1)\\ \hline\cr(0\ 0\ 0)&0&1\ell&2\ell&1\ell&3\ell&2\ell&1\ell&2\ell\\ (0\ 0\ 1)&1\ell&0&1\ell&2\ell&2\ell&3\ell&2\ell&1\ell\\ (0\ 1\ 0)&2\ell&1\ell&0&1\ell&1\ell&2\ell&3\ell&2\ell\\ (0\ 1\ 1)&1\ell&2\ell&1\ell&0&2\ell&1\ell&2\ell&3\ell\\ (1\ 0\ 0)&3\ell&2\ell&1\ell&2\ell&0&1\ell&2\ell&1\ell\\ (1\ 0\ 1)&2\ell&3\ell&2\ell&1\ell&1\ell&0&1\ell&2\ell\\ (1\ 1\ 0)&1\ell&2\ell&3\ell&2\ell&2\ell&1\ell&0&1\ell\\ (1\ 1\ 1)&2\ell&1\ell&2\ell&3\ell&1\ell&2\ell&1\ell&0\end{array}$$

For any ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$, the Hamming distance $H(\psi({\bf a}),\psi({\bf b}))$ is calculated as following.

$$\begin{array}[]{c|cccccccc}H(\psi({\bf a}),\psi({\bf b}))&{\bf x}{\bf y}{\bf x}^{c}&\hskip 8.53581pt{\bf x}{\bf y}{\bf x}&\hskip 8.53581pt{\bf x}{\bf y}^{c}{\bf x}&\hskip 8.53581pt{\bf x}{\bf y}^{c}{\bf x}^{c}&\hskip 8.53581pt{\bf x}^{c}{\bf y}^{c}{\bf x}&\hskip 8.53581pt{\bf x}^{c}{\bf y}^{c}{\bf x}^{c}&\hskip 8.53581pt{\bf x}^{c}{\bf y}{\bf x}^{c}&\hskip 8.53581pt{\bf x}^{c}{\bf y}{\bf x}\\ \hline\cr{\bf x}{\bf y}{\bf x}^{c}&0&1\ell&2\ell&1\ell&3\ell&2\ell&1\ell&2\ell\\ {\bf x}{\bf y}{\bf x}&1\ell&0&1\ell&2\ell&2\ell&3\ell&2\ell&1\ell\\ {\bf x}{\bf y}^{c}{\bf x}&2\ell&1\ell&0&1\ell&1\ell&2\ell&3\ell&2\ell\\ {\bf x}{\bf y}^{c}{\bf x}^{c}&1\ell&2\ell&1\ell&0&2\ell&1\ell&2\ell&3\ell\\ {\bf x}^{c}{\bf y}^{c}{\bf x}&3\ell&2\ell&1\ell&2\ell&0&1\ell&2\ell&1\ell\\ {\bf x}^{c}{\bf y}^{c}{\bf x}^{c}&2\ell&3\ell&2\ell&1\ell&1\ell&0&1\ell&2\ell\\ {\bf x}^{c}{\bf y}{\bf x}^{c}&1\ell&2\ell&3\ell&2\ell&2\ell&1\ell&0&1\ell\\ {\bf x}^{c}{\bf y}{\bf x}&2\ell&1\ell&2\ell&3\ell&1\ell&2\ell&1\ell&0\end{array}$$

Recall that, for any ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$, $H({\bf x},{\bf x}^{c})$ = $H({\bf y},{\bf y}^{c})$ = $\ell$. Hence, it is clear the $d_{NHo}({\bf a},{\bf b})$ = $H(\psi({\bf a}),\psi({\bf b}))$ for each ${\bf a},{\bf b}\in\mathbb{Z}_{2}^{3}$.

The parameters of DNA codes obtained from any given binary codes are given in Theorem 5.4.

Theorem 5.4

For any $(n,M,d_{NHo})$ binary code $\mathscr{C}$, an $(n\ell,M,d_{H})$ DNA code $\psi(\mathscr{C})$ exists, where $d_{H}=d_{NHo}$.

Proof

The result is obtained from Theorem 5.3 and the definition of $\ell$ order Non-Homopolymer map.

5.3 Constructions of DNA Codes

From Theorem 5.4, for suitable ${\bf x},{\bf y}\in\Sigma_{DNA}^{\ell}$, DNA codes can be obtained from any binary codes that satisfy

• Tandem-free constraint with repeat-length $\lfloor n/2\rfloor$,

• Hamming constraint,

• R constraint,

• RC constraint, and

• $GC$-content constraint.

Thus, in this section, all the DNA codes discussed in this section satisfy all these properties togeter. For example, as given in (Benerjee2021, , Table 4), one can get

• $(n\ell,2,n\ell)$ DNA code from the binary code $\{(0\ {\bf x}),(1\ {\bf x})\}$ for any given ${\bf x}\in\mathbb{Z}_{2}^{n-1}$,

• $(4\ell,2,2\ell)$ DNA code from $[4,1,4]$ repetition code,

• $(7\ell,16,2\ell)$ DNA code from $[7,4,3]$ Hamming code,

• $(15\ell,256,3\ell)$ DNA code from $(15,256,5)$ Nordstrom-Robinson code, and

• $(23\ell,4096,4\ell)$ DNA code from $[23,12,7]$ Golay code.

In particular, for $\ell$ = $2$, if ${\bf x}$ = $AT$ and ${\bf y}$ = $CG$ then,

• from the binary code $\{(0\ 0\ 1\ 0),(1\ 0\ 1\ 0)\}$, one can get the $(6,2,6)$ DNA code with the DNA codewords

  $$\begin{array}[]{cll}\psi((0\ 0\ 1\ 0))=&{\bf x}{\bf y}{\bf x}{\bf y}&=ATCGTAGC,\mbox{ and }\\ \psi((1\ 0\ 1\ 0))=&{\bf x}^{c}{\bf y}^{c}{\bf x}^{c}{\bf y}^{c}&=TACGATGC.\end{array}$$

• from the $[4,1,4]$ binary repetition code, one can get the $(8,2,4)$ DNA code with the DNA codewords

  $$\begin{array}[]{cll}\psi((0\ 0\ 0\ 0))=&{\bf x}{\bf y}{\bf x}^{c}{\bf y}^{c}&=ATCGTAGC,\mbox{ and }\\ \psi((1\ 1\ 1\ 1))=&{\bf x}^{c}{\bf y}{\bf x}{\bf y}^{c}&=TACGATGC.\end{array}$$

• from the $[7,4,3]$ binary Hamming code, one can get the $(21,16,6)$ DNA code with the DNA codewords

  $$\begin{array}[]{cll}\psi((0\ 0\ 0\ 0\ 0\ 0\ 0))=&{\bf x}{\bf y}{\bf x}^{c}{\bf y}^{c}{\bf x}{\bf y}{\bf x}^{c}&=ATCGTAGCATCGTA,\\ \psi((1\ 1\ 1\ 0\ 0\ 0\ 0))=&{\bf x}^{c}{\bf y}{\bf x}{\bf y}{\bf x}^{c}{\bf y}^{c}{\bf x}&=TACGATCGTAGCAT,\\ \psi((1\ 0\ 0\ 1\ 1\ 0\ 0))=&{\bf x}^{c}{\bf y}^{c}{\bf x}{\bf y}^{c}{\bf x}^{c}{\bf y}^{c}{\bf x}&=TAGCATGCTAGCAT,\\ \psi((0\ 1\ 1\ 1\ 1\ 0\ 0))=&{\bf x}{\bf y}^{c}{\bf x}^{c}{\bf y}{\bf x}{\bf y}{\bf x}^{c}&=ATGCTAGCATCGTA,\\ \psi((0\ 1\ 0\ 1\ 0\ 1\ 0))=&{\bf x}{\bf y}^{c}{\bf x}{\bf y}^{c}{\bf x}{\bf y}^{c}{\bf x}&=ATGCATGCATGCAT,\\ \psi((1\ 0\ 1\ 1\ 0\ 1\ 0))=&{\bf x}^{c}{\bf y}^{c}{\bf x}^{c}{\bf y}{\bf x}^{c}{\bf y}{\bf x}^{c}&=TAGCTACGTACGTA,\\ \psi((1\ 1\ 0\ 0\ 1\ 1\ 0))=&{\bf x}^{c}{\bf y}{\bf x}^{c}{\bf y}{\bf x}{\bf y}^{c}{\bf x}&=TACGTACGATGCAT,\\ \psi((0\ 0\ 1\ 0\ 1\ 1\ 0))=&{\bf x}{\bf y}{\bf x}{\bf y}{\bf x}{\bf y}^{c}{\bf x}&=ATCGATCGATGCAT,\\ \psi((1\ 1\ 0\ 1\ 0\ 0\ 1))=&{\bf x}^{c}{\bf y}{\bf x}^{c}{\bf y}{\bf x}^{c}{\bf y}^{c}{\bf x}^{c}&=TACGTACGTAGCTA,\\ \psi((0\ 0\ 1\ 1\ 0\ 0\ 1))=&{\bf x}{\bf y}{\bf x}{\bf y}^{c}{\bf x}{\bf y}{\bf x}&=ATCGATGCATCGAT,\\ \psi((0\ 1\ 0\ 0\ 1\ 0\ 1))=&{\bf x}{\bf y}^{c}{\bf x}{\bf y}{\bf x}{\bf y}{\bf x}&=ATGCATGCATCGAT,\\ \psi((1\ 0\ 1\ 0\ 1\ 0\ 1))=&{\bf x}^{c}{\bf y}^{c}{\bf x}^{c}{\bf y}^{c}{\bf x}^{c}{\bf y}^{c}{\bf x}^{c}&=TAGCTAGCTAGCTA,\\ \psi((1\ 0\ 0\ 0\ 0\ 1\ 1))=&{\bf x}^{c}{\bf y}^{c}{\bf x}{\bf y}{\bf x}^{c}{\bf y}{\bf x}&=TAGCATCGTACGAT,\\ \psi((0\ 1\ 1\ 0\ 0\ 1\ 1))=&{\bf x}{\bf y}^{c}{\bf x}^{c}{\bf y}^{c}{\bf x}{\bf y}^{c}{\bf x}^{c}&=ATGCTAGCATGCTA,\\ \psi((0\ 0\ 0\ 1\ 1\ 1\ 1))=&{\bf x}{\bf y}{\bf x}^{c}{\bf y}{\bf x}{\bf y}^{c}{\bf x}^{c}&=ATCGTACGATGCTA,\mbox{ and }\\ \psi((1\ 1\ 1\ 1\ 1\ 1\ 1))=&{\bf x}^{c}{\bf y}{\bf x}{\bf y}^{c}{\bf x}{\bf y}{\bf x}^{c}&=TACGATGCATCGTA.\end{array}$$

6 Algebraic Bounds on DNA Codes

All the notations used in this section is defined as follows. For the given length $n$ and the minimum Hamming distance $d_{H}$,

$A_{2}(n,d_{H})$:

The maximum size of the binary code.

$A_{2}(n,d_{H},w)$:

The maximum size of the binary constant weight code, where each codeword has the Hamming weight $w$.

$A_{3}(n,d_{H},w)$:

The maximum size of the ternary constant weight code, where each codeword has the Hamming weight $w$.

$A_{4}(n,d_{H})$:

The maximum size of the DNA code.

$A_{2}^{r}(n,d_{H})$:

The maximum size of the binary code, where the DNA code satisfies R constraint.

$A_{2}^{r}(n,d_{H},w)$:

The maximum size of the binary constant weight code, where each codeword has the Hamming weight $w$ and the binary code satisfies the R constraint.

$A_{3}^{r}(n,d_{H},w)$:

The maximum size of the ternary constant weight code, where each codeword has the Hamming weight $w$ and the ternary code satisfies the R constraint.

$A_{4}^{r}(n,d_{H})$:

The maximum size of the DNA code, where the DNA code satisfies R constraint.

$A_{4}^{rc}(n,d_{H})$:

The maximum size of the DNA code, where the DNA code satisfies RC constraint.

$A_{4}^{GC}(n,d_{H},w)$:

The maximum size of the DNA code with $GC$-weight $w$, where the DNA code satisfies fixed $GC$-content constraint with weight $w$.

$A_{4}^{r,GC}(n,d_{H},w)$:

The maximum size of the DNA code with $GC$-weight $w$, where the DNA code satisfies R constraint and fixed $GC$-content constraint with weight $w$.

$A_{4}^{rc,GC}(n,d_{H},w)$:

The maximum size of the DNA code with $GC$-weight $w$, where the DNA code satisfies RC constraint and fixed $GC$-content constraint with weight $w$.

$A_{4}^{r,rc}(n,d_{H})$:

The maximum size of the DNA code, where the DNA code satisfies R and RC constraints.

$A_{4}^{r,rc,GC}(n,d_{H},w)$:

The maximum size of the DNA code with $GC$-weight $w$, where the DNA code satisfies R constraint, RC constraint and fixed $GC$-content constraint with weight $w$.

$A_{4}^{GC,Homo}(n,d_{H},w)$:

The maximum size of the DNA code with and $GC$-weight $w$, where the DNA code satisfies fixed $GC$-content constraint with weight $w$, and each DNA codeword is free from Homopolymers.

Now, from the literature, the bounds on DNA codes with various constraints are following.

1. (doi:10.1089/10665270152530818, , Theorem 3.1) (Sphere-Packing bound): For given integer $n$ and $1\leq d_{H}\leq n$,

   $$A_{4}(n,d_{H})\leq\frac{4^{n}}{\sum_{i=0}^{\lfloor(d_{H}-1)/2\rfloor}\binom{n}{i}3^{i}}.$$

2. (doi:10.1089/10665270152530818, , Theorem 3.2) (Gilbert–Varshamov bound): For given integer $n$ and $1\leq d_{H}\leq n$,

   $$A_{4}(n,d_{H})\geq\frac{4^{n}}{\sum_{i=0}^{d_{H}-1}\binom{n}{i}3^{i}}.$$

3. (doi:10.1089/10665270152530818, , Theorem 3.3) (Singleton bound): For given integer $n$ and $1\leq d_{H}\leq n$,

   $$A_{4}(n,d_{H})\leq 4^{n-d_{H}+1}.$$

4. (doi:10.1089/10665270152530818, , Theorem 3.4) (Plotkin bound): For given integer $n$ and $3n/2<d_{H}\leq n$,

   $$A_{4}(n,d_{H})\leq\frac{4d_{H}}{4d_{H}-3n}.$$

5. (doi:10.1089/10665270152530818, , Theorem 3.5) For given integer $n$ and $1\leq d_{H}\leq n$,

   • $A_{4}(n,d_{H})\geq A_{4}(n+1,d_{H}+1)$, and

   • $A_{4}(n,d_{H})\geq A_{4}(n+1,d_{H})/4$.

6. (doi:10.1089/10665270152530818, , Theorem 4.1) For given even integer $n$ and $1\leq d_{H}\leq n$,

   $$A_{4}^{rc}(n,d_{H})=A_{4}^{r}(n,d_{H}).$$

7. (doi:10.1089/10665270152530818, , Theorem 4.1) For given odd integer $n$ and $1\leq d_{H}\leq n$,

   $$A_{4}^{r}(n,d_{H}+1)\leq A_{4}^{rc}(n,d_{H})\leq A_{4}^{r}(n,d_{H}-1).$$

8. (GABORIT200599, , Proposition 2) For given odd integer $n$ and $1\leq d_{H}\leq n$,

   $$A_{4}^{rc}(n,d_{H})\leq A_{4}^{r}(n,d_{H})/2.$$

9. (doi:10.1089/10665270152530818, , Theorem 4.3) For given integer $n$ and $1\leq d_{H}\leq n$, consider a set $S$ of all DNA strings of length $n$ such that, for any ${\bf x},{\bf y}\in S$, $H({\bf x},{\bf y}^{r})\geq d_{H}$ and ${\bf x}\neq{\bf y}$. Then,

   $$A_{4}^{r}(n,d_{H})\geq\frac{4^{\lceil n/2\rceil}}{2V^{+}(d_{H}-1)}\sum_{i=\lceil d_{H}/2\rceil}^{\lfloor n/2\rfloor}\binom{\lfloor n/2\rfloor}{i}3^{i},$$

   where $V^{+}(d_{H})$ is the maximum size of the set $S$ for given $d_{H}$.

10. (doi:10.1089/10665270152530818, , Theorem 4.4) (Halving bound): For given integer $n$ and $1\leq d_{H}\leq n$,

    $$A_{4}^{r}(n,d_{H})\leq A_{4}(n,d_{H})/2,$$

    where, for the $(n,A_{4}^{r}(n,d_{H}),d_{H})$ DNA code $\mathscr{C}_{DNA}$, if ${\bf x}\in\mathscr{C}_{DNA}$ then ${\bf x}^{r}\notin\mathscr{C}_{DNA}$.

11. (doi:10.1089/10665270152530818, , Theorem 4.5) (Cai’s lower bound): For given integer $n$ and $1\leq d_{H}\leq n$,

    $$A_{4}^{r}(2n,2d_{H})\geq\lfloor A_{4}(n,d_{H})/2\rfloor.$$

12. (doi:10.1089/10665270152530818, , Theorem 4.7) (Product bound): For given integer $n$ and $1\leq d_{H}\leq n$,

    $$A_{4}^{r}(n,d_{H})\geq A_{2}^{r}(n,d_{H})\cdot A_{2}(n,d_{H}).$$

13. (doi:10.1089/10665270152530818, , Theorem 4.9) For given integer $n$ and $1\leq d_{H}\leq n$,

    • $A_{4}^{r}(n,d_{H})\leq A_{4}^{r}(n,d_{H}-1)$, and

    • $A_{4}^{r}(n,d_{H})/4\leq A_{4}^{r}(n-1,d_{H})\leq A_{4}^{r}(n,d_{H})$ for odd $n$.

14. (GABORIT200599, , Proposition 5) For given odd integer $n$ and $1\leq d_{H},w\leq n$,

    $$A_{4}^{rc,GC}(n,d_{H},w)\leq A_{4}^{r,GC}(n,d_{H},w)/2.$$

15. (GABORIT200599, , Proposition 9) For given integer $n$ and $1\leq d_{H},w\leq n$,

    $$A_{4}^{rc,GC}(n,d_{H},w)\geq A_{2}^{r}(n,d_{H},w)\cdot A_{2}(n,d_{H}).$$

16. (GABORIT200599, , page no. 110) For given integer $n$ and $1\leq d_{H},w\leq n$,

    • $A_{4}^{rc,GC}(n,d_{H},w)\leq A_{4}^{rc,GC}(n,d_{H}-1,w)$, and

    • $A_{4}^{rc,GC}(n,d_{H},w)\leq A_{4}^{rc,GC}(n+1,d_{H},w)$.

17. (King2003, , Proposition 1) For given integer $n$ and $1\leq d_{H},w\leq n$,

    • $A_{4}^{GC}(n,d_{H},w)=A_{4}^{GC}(n,d_{H},n-w)$, and

    • $A_{4}^{GC}(n,d_{H},0)=A_{2}(n,d_{H})$.

18. (King2003, , Theorem 2) (Johnson-type bound): For given integer $n$ and $1\leq d_{H},w\leq n$,

    • $A_{4}^{GC}(n,d_{H},w)\leq\left\lfloor\frac{2n}{w}A_{4}^{GC}(n-1,d_{H},w-1)\right\rfloor$, and

    • $A_{4}^{GC}(n,d_{H},w)\leq\left\lfloor\frac{2n}{n-w}A_{4}^{GC}(n-1,d_{H},w)\right\rfloor$.

19. (King2003, , Theorem 5) For given integer $n$ and $1\leq d_{H},w\leq n$, if $2nd_{H}>n^{2}+2nw-2w^{2}$ then

    $$A_{4}^{GC}(n,d_{H},w)\leq\frac{2nd_{H}}{2nd_{H}-(n^{2}+2nw-2w^{2})}.$$

20. (King2003, , Theorem 8) (Gilbert-type bound): For given integer $n$ and $1\leq d_{H},w\leq n$,

    $$A_{4}^{GC}(n,d_{H},w)\geq\frac{\binom{n}{w}2^{n}}{\sum_{r=0}^{d_{H}-1}\sum_{i=0}^{\min\{\lfloor r/2\rfloor,w,n-w\}}\binom{w}{i}\binom{n-w}{i}\binom{n-2i}{r-2i}2^{2i}}.$$

21. (King2003, , Theorem 11) (Gilbert-type bound): For given integer $n$ and $1\leq d_{H},w\leq n$,

    $$A_{4}^{rc,GC}(n,d_{H},w)\geq\frac{\sum_{r=d_{H}}^{n}V(n,r,w)}{2\sum_{r=0}^{d_{H}-1}\sum_{i=0}^{\min\{\lfloor r/2\rfloor,w,n-w\}}\binom{w}{i}\binom{n-w}{i}\binom{n-2i}{r-2i}2^{2i}},$$

    where $V(n,r,w)$ is the size of the set

    $$\{{\bf x}:H({\bf x},{\bf x}^{rc})=r\mbox{ and }w_{GC}({\bf x})=w\mbox{ for }{\bf x}\in\Sigma_{DNA}^{n}\}.$$

22. (King2003, , Proposition 12) For given integer $n$ and $1\leq d_{H},w\leq n$,

    • $A_{4}^{rc,GC}(n,d_{H},w)$ = $A_{4}^{r,GC}(n,d_{H},w)$ for even $n$, and

    • $A_{4}^{r,GC}(n,d_{H}+1,w)\leq A_{4}^{rc,GC}(n,d_{H},w)\leq A_{4}^{r,GC}(n,d_{H}-1,w)$ for odd $n$.

23. (King2003, , Theorem 13) For given integer $n$ and $1\leq d_{H},w\leq n$,

    • $A_{4}^{GC}(n,d_{H},w)\geq A_{2}(n,d_{H},w)\cdot A_{2}(n,d_{H})$,

    • $A_{4}^{r,GC}(n,d_{H},w)\geq A_{2}^{r}(n,d_{H},w)\cdot A_{2}(n,d_{H})$,

    • $A_{4}^{r,GC}(n,d_{H},w)\geq A_{2}(n,d_{H},w)\cdot A_{2}(n,d_{H})^{r}$,

    • $A_{4}^{GC}(n,d_{H},w)\geq A_{3}(n,d_{H},w)\cdot A_{2}(n-w,d_{H})$,

    • $A_{4}^{r,GC}(n,d_{H},w)\geq A_{3}^{r}(n,d_{H},w)\cdot A_{2}(n-w,d_{H})$, and

    • $A_{4}^{r,GC}(n,d_{H},w)\geq A_{3}(n,d_{H},w)\cdot A_{2}^{r}(n-w,d_{H})$.

24. (8424143, , Theorem 2) For given integer $n$ and $1\leq d_{H},w\leq n$,

    $$A_{4}^{GC,Homo}(n,d_{H},w)\geq\frac{B(n,w)}{\sum_{r=0}^{d_{H}-1}\sum_{i=0}^{\min\{\lfloor r/2\rfloor,w,n-w\}}\binom{w}{i}\binom{n-w}{i}\binom{n-2i}{r-2i}2^{2i}},$$

    where

    $$B(n,w)=\sum_{j=0}^{v-1}2^{2v+1-2j}\binom{v-1}{j}\binom{n-v}{v-j}+\sum_{j=0}^{v-2}2^{2v-1-2j}\binom{v-1}{j}\binom{n-v-1}{v-j-2},$$

    and $v$ = $\min\{w,n-w\}$.

7 Some Open Problems

The designing of DNA codes with the desired properties is somewhat still an open challenge despite of so much literature. In this chapter, we presented an algebraic approach for the construction of DNA codes. We summarise the following research directions that one can explore further.

Problem 7.1

Exploring algebraic structures such as other finite rings and finite fields that can yield DNA codes with high minimum Hamming distance.

Problem 7.2

Developing techniques for handling new constraints (such as secondary structure formation) via algebraic means arising from DNA storage applications.

Problem 7.3

Using computational tools such as Magma together with codes over finite algebraic structures and computational techniques in constructing large set of DNA codes.

Problem 7.4

Updating the Tables of DNA codes by filling the gaps.

Problem 7.5

Finding tight bounds on DNA codes with various constraints and properties.

Problem 7.6

Finding optimal codes (bounds achieving) DNA codes with various constraints and properties.