High Information Density and Low Coverage Data Storage in DNA with Efficient Channel Coding Schemes

Abstract

DNA-based data storage has been attracting significant attention due to its extremely high density, low power consumption, and long duration compared to traditional data storage mediums. Despite the recent advancements in DNA data storage technology, significant challenges remain. In particular, various types of errors can occur during the processes of DNA synthesis, storage, and sequencing, including substitution errors, insertion errors, and deletion errors. Furthermore, the entire oligo may be lost. In this work, we report a DNA-based data storage architecture that incorporates efficient channel coding schemes, including different types of error-correcting codes (ECCs) and constrained codes, for both the inner coding and outer coding for the DNA data storage channel. We also carry out large scale experiments to validate our proposed DNA data storage architecture. Specifically, 1.61 and 1.69 MB data are encoded into 30,000 oligos each, with information densities of 1.731 and 1.815, respectively. It has been found that the stored information can be fully recovered without any error at average coverages 4.5 and 6.0, respectively. Compared to previous experimental studies, our architecture achieves higher information density and lower coverage, demonstrating the efficiency of the proposed channel coding schemes.

1 Introduction

Figure 1: The workflow of the designed DNA-based data storage system with the structure of an oligo. 30,000 oligos of length 296 nucleotides were synthesized for two different coding schemes. In Scheme 1, each oligo has 226 nucleotides as data payload, 8 nucleotides as seed, 14 nucleotides as redundancy to remove homopolymers runs of more than 4, and to detect or correct errors, 2 nucleotides as the indicator of different coding schemes, and 46 nucleotides as primers. In Scheme 2, each oligo has 233 nucleotides as data payload, 8 nucleotides as seed, 7 nucleotides as redundancy to remove homopolymers runs of more than 4, and to detect or correct errors, 2 nucleotides as the indicator of different coding schemes, and 46 nucleotides as primers. After the processes of DNA synthesis and storage, Illumina sequencing was applied to the DNA pool to obtain 24 million oligos. The source data was recovered after the decoding process.

Table 1: The comparison between the designed architecture and previous work

	Data size (MB)	Number of oligos	Net information density (bits/nt)	Coverage(x)
Church et al. [1]	0.65	54,898	0.83	3000
Goldman et al. [2]	0.63	153,335	0.33	51
Grass et al. [3]	0.08	4,991	1.14	372
Bornholt et al. [4]	0.15	151,000	0.88	40
Blawat et al. [5]	22	1,000,000	0.92	160
Erlich et al. [6]	2.11	72,000	1.57	10.5
Organick et al. [7]	200.2	13,400,000	1.1	5
Wang et al. [8]	0.38	11,400	1.67	10
This work (Scheme 1)	1.61	30,000	1.731	4.5
This work (Scheme 2)	1.69	30,000	1.815	6.0

Digital data is currently generated by humanity at an unprecedented rate. It is suggested that demand for data storage globally will surge to $1.75\times 10^{14}$ GB in 2025 [9]. Meanwhile, conventional storage technologies can hardly meet future needs due to their inherent limitations, such as restricted information density and longevity. Although the current data storage technology has a theoretical information density of up to $10^{3}$ GB/mm³, in practical, the data storage density of the most advanced enterprise solid state drive (SSD) is less than 1 GB/mm³. Therefore, it requires a volume of $1.75\times 10^{5}$ m³ to store all the data that will be produced in 2025 with the current data storage technology. In response to this surging demand for data storage, there has been a great attraction towards DNA-based data storage technology, due to its extremely high data storage density, long lasting stability of hundreds to a thousand year, and ultra-low power consumption for operation and maintenance [10]. With a storage density of around $1.7\times 10^{10}$ GB/g [11], only $10^{-2}$ m³ DNA is required to store the same amount of data for 2025, thus demonstrating the significant potential of DNA-based data storage technology.

The basic unit of DNA data storage is a DNA strand/string (or oligonucleotides, or oligo in short), which is a linear sequence of four types of nucleotides: adenine (A), cytosine (C), guanine (G), and thymine (T). Each nucleotide (also known as the DNA base) can represent two bits of information. The DNA synthesizer will create up to $10^{6}$ copies of each DNA strand, which is essentially the write process. After that, all these oligos are mixed together in an oligo pool, which serves as the storage media. During the read process, to increase the oligo concentration for the ease of reading, a so-called polymerase chain reaction (PCR) is performed to amplify the oligos in the pool [10]. Reading information in DNA data storage is realized by randomly and independently sequencing the oligos in the pool, with each sequenced oligo as one read. A DNA string/strand/oligo can be missing or corrupted by insertion, deletion, and/or substitution errors during the synthesis, storage, and sequencing processes. Therefore, error-correcting codes are usually applied to detect or correct these errors by introducing certain amount of redundancy. In a typical DNA-based data storage system, an inner code is used to detect/correct the errors within a string, whereas an outer code is used to recover the missing strings and correct the erroneous strings from inner decoding. Furthermore, two biological properties that significantly increase the occurrence of errors for most synthesis and sequencing techniques are the long homopolymer runs (a segment of DNA strand with identical nucleotides), and unbalanced GC-content (deviation of the proportion of guanine (G) and cytosine (C) proportion from 50%) within a DNA strand. This inspired the application of the constrained code to convert binary data into DNA strands which do not have long runs of homopolymer and whose GC-content is around 50% [12, 13].

Several experiments with different DNA data storage architectures have been carried out to demonstrate the efficiency of DNA-based data storage system. Except for [1], most of these works have employed various channel coding techniques [1, 2, 3, 4, 5, 6, 7, 8, 14]. In particular, Reed-Solomon (RS) codes were adopted as the outer code in [3, 5, 7, 8], while RS codes and Cyclic Redundancy Check (CRC) were utilized as the inner code in [3, 6, 7] and [5, 8, 14], respectively. The repetition methods have also been employed in [2, 4] to tackle the substitution and erasure errors.

In [6], Erlich et al. adopted the Luby transform codes, known as the first practical class of fountain codes [15], as the outer code, highlighting that the rateless nature of fountain codes enables its efficient combination with the constrained code for DNA data storage. In particular, the encoder first generate a large number of codewords, and it then rejects those that do not satisfy the homopolymer runlength constraint and the GC-content constraint. Subsequently, another class of fountain codes, Raptor codes [16] were employed as the outer code in [14]. Welzel et al. [14] proposed a concatenated coding scheme capable of generating oligos that adhere to user-defined constraints, and correct the edit and erasure errors.

In this work, we propose a DNA-based data storage architecture consisting of efficient channel coding techniques. The workflow of our proposed architecture is depicted in Fig. 1. Its performance was evaluated through experiments, and corresponding main results and their comparison with previous works are shown in Table 1. To the best of our knowledge, this study achieves the highest information density and nearly the lowest coverage compared to all previous experiments.

Figure 2: Encoding process of the designed DNA-based data storage system. After the data segmentation, the encoded symbols were generated. This was followed by the sequence replacement, inner code encoding, seed attaching, and indicator attaching. Only oligos adhere to the run length constraint of 3 and the GC-content of 45% to 55% were included in the oligos designed file.

2 Results

2.1 Encoding Schemes

In our proposed DNA data storage architecture, the source data is first encoded by a combined encoder of the outer ECC code, inner ECC code, and the constrained code. The corresponding encoding process is illustrated by Fig. 2. Two coding schemes, in particular, Scheme 1 and Scheme 2, distinguished by the first and the last nucleotides, have been applied. Both schemes followed the identical encoding workflow as depicted in Fig. 2, while Scheme 2 has a lower logical redundancy, thereby achieving a higher information density. In this studies, we mapped nucleotides ’A, T, C, G’ to ’00, 01, 10, 11’ and ’0, 1, 2, 3’, respectively. In this paper, we might alternate those notations when it is convenient. In the experiment, a modified Raptor 10 (modified-R10, refer to Section 4.1 for details) code [17] and a single edit reconstruction code (refer to Section 4.3 for details) were adopted as the outer code and the inner code, respectively. As for the constrained code, a modified sequence replacement technique (modified-SRT, refer to Section 4.2 for details) was employed to remove long homopolymers, and the rateless nature of fountain codes was leveraged to ensure that only the oligos with valid homopolymers and GC-content were synthesized. Key parameters of each encoding scheme are illustrated below.

• Modified-R10 code encoding: The modified-R10 code encoding was performed following the data segmentation. Similar to [6], each encoded symbol consisted of two components: a unique seed and a data payload, where the latter represented a bitwise XOR (i.e., module 2 addition) result of one or more source symbols. The seed in this study was 8 nucleotides long. In this step, in Scheme 1 and Scheme 2, 28,500 and 28,970 source symbols were encoded into 30,000 symbols, leading to the outer code rates of 0.95 and 0.9657, respectively.

• Modified-SRT encoding: 5 nucleotides were introduced as redundancy to replace the homopolymers. In this study, we limited the maximum run length to 3, rendering all the homopolymers of length 4 nucleotides to be removed in this stage.

• Single edit reconstruction code encoding: 9 and 2 nucleotides were added as redundancy to tackle the potential edit errors (insertions, deletions, or substitution errors) introduced by the DNA channel in Schemes 1 and 2, respectively. Notably, only one edit error is possible to be corrected.

Remark 1

After the single edit reconstruction code encoding, two identical nucleotides were added at both the start and end of the oligo to indicate which scheme the oligo derived from. ’A’ for Scheme 1 while ’C’ for Scheme 2. Note that without the indicators, but using two pairs of primers can also distinguish the coding schemes, however, it will significantly improve expense of the experiment. Therefore, we adopted different indicators under uniform primer in the experiment. From this point of view, the indicators should be regarded as a part of the primers and we thus ignore the indicators and primers as usual when computing net information densities of the coding schemes.

Following the encoding schemes illustrated above, the information densities for Scheme 1 and Scheme 2 are $2\times\frac{226}{248}\times\frac{28500}{30000}=1.731$ bits/nt and $2\times\frac{233}{248}\times\frac{28970}{30000}=1.815$ bits/nt, respectively.

2.2 Experimente Design

The oligos pool was synthesized by Twist Bioscience, incorporating the primer ’GCAGCCCAATGTGTTCGGTCTAC’ on the $5^{\prime}$ side and ’ACTGGGTGTTGTCTCTTCGAGCC’ on the $3^{\prime}$ side. 30,000 oligos were synthesized for Schemes 1 and 2, respectively.

During the sequencing phase, it is noteworthy that at most 250 nucleotides can be sequenced in a single read for the Illumina sequencer. Accordingly, each oligo was sequenced twice, starting from both ends of it, rendering the sequencing result of each oligo denoted by its forward and reverse fragments. These fragments were then merged utilizing the Fast Length Adjustment of SHort reads (FLASH) algorithm [18]. Following the data filtration, 24 million oligos were finally gotten. The mean coverage is 404.0 with a standard derivation of 234.8.

2.3 Raw Data Analysis

We evaluated the base error rate, oligo error rate, length distribution, and read number distribution. These evaluations and analyses were performed on all the oligos rather than for each scheme separately as the distributions of both schemes showed significant similarity.

The distributions of read number for all strands and those with coverage of 5x are shown in Fig. 3 and Fig. 4, respectively. Furthermore, the analysis of the base error rate within the data payload region was also derived. The result is presented in Table 2. This analysis revealed that substitutions were the dominant error type, occurring approximately 2.5 times as much as deletions, and 14.5 times as much as insertions, consistent with findings reported in [7].

The analysis of the oligo error rate is shown in Table 3. The length distribution of all strands is depicted in Table 4. These analyses both emphasize that the number of oligos with lengths less than 250 was much greater than those with lengths greater than 250. This trend can be attributed to the notably higher deletion error rate as indicated in Table 2.

Figure 3: Read number distribution of all the strands.

Figure 4: Read number distribution of coverage equals 5x.

Table 2: Error rate of nucleotides except for primer region after sequencing

	insertion	deletion	substitution	total rate
	rate	rate	rate	/%
A	$9.21\times 10^{-6}$	$6.44\times 10^{-5}$	$1.16\times 10^{-4}$	24.67
T	$4.32\times 10^{-6}$	$6.36\times 10^{-5}$	$1.20\times 10^{-4}$	25.39
C	$5.81\times 10^{-6}$	$6.50\times 10^{-5}$	$1.72\times 10^{-4}$	25.48
G	$2.37\times 10^{-5}$	$6.34\times 10^{-5}$	$2.17\times 10^{-4}$	24.47
Total	$4.31\times 10^{-5}$	$2.56\times 10^{-4}$	$6.25\times 10^{-4}$	100

Table 3: Oligo error rate

edit errors	ins	del	sub	numbers	rate/%
0	0	0	0	20380197	85.77
1	0	0	1	1932524	8.133
1	0	1	0	440656	1.854
1	1	0	0	214364	0.902
2	0	0	2	224483	0.945
2	0	2	0	83018	0.349
2	0	1	1	41528	0.175
2	1	0	1	20554	0.0865
2	1	1	0	4568	0.0192
2	2	0	0	1328	0.00559
$>2$	-	-	-	419272	1.764

Table 4: Length distribution of all strands

length/nts	numbers	rate/%
$<249$	507798	2.09
249	536876	2.21
250	22936606	94.62
251	255939	1.06
$>251$	7827	0.032

2.4 Data Recovery

For a given coding scheme and coverage $c$, the process of downsampling experiment is shown in Fig. 5. Specifically, the downsampling is first carried out by randomly taking $30000\times c$ strings from the corresponding 12 million sequencing oligos. Next, The strings exceeding the length range of [249, 251] were discarded as the inner code adopted in this experiment was only capable of correcting one edit error. Subsequently, the strings were clustered by the seed, and the logical decoding was carried. Logical decoding comprises three sequential stages: Sequence reconstruction (inner code decoding), followed by constrained code decoding, and outer code decoding.

Figure 5: The workflow of the downsampling experiment. After the downsampling, the length check was performed to discard the strings that are too long or too short. In specific, strings with length less than 249 or greater than 251 were discarded. This was followed by logical decoding, consisted of the inner, constrained and outer code decoding. The sequence reconstruction was implementing on the strings sharing the same seed. Thereafter, the constrained code decoding was applied on each string, following by the outer code decoding to conclude.

Firstly, the sequence reconstruction was performed on each cluster, with the cluster being discarded if the decoding result doesn’t form a codeword. Two different inner code decoding strategies were applied, namely the “detection” strategy and the “decoding” strategy. For strings that didn’t form codewords, the “detection” approach discarded them whereas the “decoding” one performed decoding on them. Subsequently, constrained code decoding was conducted, where the invalid strings were also discarded (refer to Section 4.2 for details). Finally, the outer code decoding was performed on all the existing strings via the modified basis-finding algorithm (modified-BFA, refer to Section 4.5 for details). The BFA [19] is designed for decoding fountain code for the channel where the received symbols could occur with errors.

The downsampling experiment completed with the outer code decoding. It was then regarded as successful if and only if the original information was recovered with no error. Assuming $T$ times downsampling experiments were made and $S$ of them were successful, we define the full data recovery success rate as $S/T$. The full data recovery success rate for different schemes and coverage is depicted in Fig. 6. At each coverage, the success rate was calculated based on 1,000 times downsampling experiments. The “UB” is the shorthand for upper bound, and the “outer UB” is a theoretical best performance of outer decoder given the inner decoding method (refer to Supplementary Material for details). From Fig. 6, it’s shown that:

(a) Decoding performance of Scheme 1.

(b) Decoding performance of Scheme 2.

Figure 6: Full data recovery success rate among 1,000 experiments, with different sequence reconstruction strategies for Schemes 1 and 2. The “outer UB” represents the theoretical best performance of outer decoder given inner decoding method.

• Compared to Scheme 2, Scheme 1 had a higher full data recovery success rate at the same coverage, resulting from the higher logical redundancy.

• The modified-BFA approached the theoretical best performance for both strategies in both schemes, revealing its effectiveness for decoding fountain codes. It is because BFA was specifically designed for decoding fountain codes for the channel that received symbols could be corrupted with errors.

• Compared to the “detection” strategy, the “decoding” strategy improved the outer upper bound in Scheme 1, whereas in Scheme 2, a deviation from this trend was observed. This trend can be explained as that Scheme 2 operated with significantly reduced redundancy. As a result, if an incorrect codeword is decoded, a large number of candidate codewords will be generated, and most of them were incorrect. It is therefore a bad trade-off for outer decoding. Take an example, decoding of a length $l$ string occurred with one substitution will generate $l$ codewords, and only one of them is correct.

3 Discussion

In this study, in both schemes, a DNA-based data storage system has been conducted with information densities 1.731 and 1.815, achieving error-free recovery with coverage requirements of 4.5 and 6.0, respectively. These results benefited from the employment of advanced channel coding techniques.

• The modified-SRT and the rateless property of the fountain codes have been utilized to ensure each oligo satisfies the predefined biological constraints (homopolymer run and GC-content). Remarkably, in this work, only 11 bits have been introduced as redundancy to adhere to run length constraint of 3 and GC content of [0.45, 0.55]. The code efficiency we achieved is 98.69% (refer to Supplementary Material for detials).

• The single edit reconstruction code has been adopted as the inner code, with redundancy of 2 nucleotides or 9 nucleotides. By implementing the efficient decoding algorithm proposed in [20], the decoder effectively utilized the information provided by all the oligos sharing the same seed.

• For outer code decoding, the modified-BFA has emerged as the most effective outer code decoder in our experiments. To the best of our knowledge, it is the state-of-the-art algorithm for decoding fountain codes in DNA-based data storage systems.

4 Methods

4.1 Modified-R10

The fountain codes, originally designed for the erasure channel, where an encoded symbol transmitted over the channel is either lost or received with no error, exhibit a rateless property, enabling its integration with constrained code encoding. Thus, prior work [6] employed a Luby transform (LT) codes [21], recognized as the first practical realization of fountain codes, as the outer code to achieve an efficient architecture. Another class of fountain codes, namely Raptor codes [16], achieve better error-correction performance while remaining linear encoding and decoding by incorporating a pre-code.

In our experiments, we employed a modified-R10, a variant of R10 code. In the encoding phase, firstly, the pre-code encoding was involved in transforming the source symbols into intermediate symbols through a linear block code encoder. Let the $\mathbf{H}_{p}$ denote the parity-check matrix of the code. The $\mathbf{H}_{p}$ was pre-designed and known to both the sender and receiver. This was followed by the LT code encoding. Let the $\mathbf{G}_{L}$ represent the generator matrix of the adopted LT code, then the generator matrix of raptor code is denoted as $\mathbf{G}=\begin{bmatrix}\mathbf{H}_{p}\\ \mathbf{G}_{L}\end{bmatrix}$. Take $\mathbf{D}$ as the intermediate symbols matrix (i.e., each row in $\mathbf{D}$ serve as an intermediate symbol). The encoding is formalized as $\mathbf{E}=\mathbf{G}\mathbf{D}=\begin{bmatrix}\mathbf{H}_{p}\\ \mathbf{G}_{L}\end{bmatrix}\times[\mathbf{D}]=\begin{bmatrix}\mathbf{0}\\ \mathbf{G}_{L}\cdot\mathbf{D}\end{bmatrix}$, where the $\mathbf{E}$ is the encoded matrix (i.e., Each row in $\mathbf{E}$ is corresponding to an encoded symbol), and $\mathbf{0}$ denotes a zero matrix. In practice, the sender can only transmit the none-zero encoded symbols.

Once the seed was generated, it used to initialize a pseudorandom number generator (PRNG). This PRNG then generated a $\mathbf{g}_{L}$ (i.e., one row in $\mathbf{G}_{L}$). Specifically, the PRNG outputted a degree $d$ according to a certain distribution. This was followed by generating $d$ integers, the corresponding $d$ positions in $\mathbf{g}_{L}$ were set to ones while others were zeros. In the decoding phrase, the $\mathbf{g}_{L}$ can be recovered from the seed.

Although the modified-R10 retained the same $\mathbf{H}_{p}$ and LT code’s degree distribution as R10, it incorporated two modifications. One was the method of producing random seed. R10 allows for a maximum of 8,912 different seeds, while in this study, the seed was initialized to zero and incremented by one in each encoding round. Another modification was that the PRNG was implemented with Mersenne twister [22].

Figure 7: An example of encoding the sequence by utilizing SRT to obtain a sequence adhering to the run length constraint of 3. The differential sequence is derived using modulo 4 subtraction for a better understanding.

4.2 Modified-SRT

The sequence replacement technique (SRT) has been widely applied [12, 13] to efficiently remove the forbidden substrings, specifically the homopolymer run. In this work, we adopted the algorithm illustrated in [13], which is capable of encoding any quaternary sequences of length $n<50$ to obtain sequences of length $n+1$ adhering to the run length constraint of 3. The key step is to transform the sequence into so called differential sequence. For a sequence $\mathbf{x}=(x_{1},x_{2},...,x_{n})\in\{0,1,2,3\}^{n}$, the differential sequence $\mathbf{y}=(y_{1},y_{2},...y_{n})\in\{0,1,2,3\}^{n}$ is defined as $y_{1}=x_{1}$ and $y_{i}=x_{i}\oplus x_{i-1}$ ($\oplus$ represents the bitwise XOR operation) for $2\leq i\leq n$. In [13], the differential sequence was derived using the module 4 subtraction operation, whereas we used the bitwise XOR operation in our experiments as they are essentially the same in this case and the bitwise XOR operation is more hardware-friendly. The encoding scenario of SRT for a block is shown as follows:

• Step 1: Obtain the differential sequence $\mathbf{y}$ from the original sequence $\mathbf{x}$.

• Step 2: Append a ’0’ on the end of $\mathbf{y}$.

• Step 3: Starting with ${y}_{2}$, search for and remove sequences of 3 consecutive zeros in $\mathbf{y}$, appending their positions to the end of $\mathbf{y}$ until no such sequence remain, yielding $\mathbf{y}^{\prime}$. In this step, to distinguish the adding positions with the zero appending in Step 2, all the positions don’t end with zero.

• Step 4: Output a sequence whose differential sequence is $\mathbf{y}^{\prime}$.

We provide a toy example to demonstrate the encoding process of the SRT in Fig. 7. This example shows how to encode the sequence $\mathbf{x}=222233$ utilizing SRT.

To illustrate why removing all sequences of 3 consecutive zeros in differential sequence can obtain a sequence adhering to the run length constraint of 3, consider the fact that each zero in differential sequence, except for the first position, corresponds to two consecutive identical symbols in original sequence. Therefore, a consecutive zeros of length $l$ in differential sequence thus indicates a consecutive identical symbols of length $l+1$ in original sequence.

To ensure unambiguous encoding, the position indicator added is always 3 digits long. Furthermore, to distinguish the zero added in the first step, the position cannot end up with zero. These requirements constrain the block size to a maximum of $4\times 4\times 3+1=49$ for the run length constraint of 3. In this experiment, the input sequence of SRT had length 234 and 241 nucleotides, limiting the direct application of the encoding scenario given above (requiring input length $n<50$). We slightly modified the SRT, shown in Fig. 8, enabling the encoding of sequences with arbitrary length. Particularly, the last 3 symbols of the encoding result of the block were regarded as the first 3 symbols of the next block to be encoded, thereby avoiding homopolymer run at block boundaries. The decoding was simply the reverse of the encoding.

Figure 8: The encoding workflow of modified-SRT for run length constraint of 3. Firstly, the input sequence is segmented into blocks. The first block has a length of 49. The others have a length of up to 46. Each block except for the first one appends the last 3 symbols of previous block’s encoding result on the beginning before the encoding.

4.3 Single edit reconstruction code

In Scheme 1, 9 nucleotides were introduced as redundancy. Define $P_{1}=\{1,2,4,8,16,32,64,128,248\}$. Let $\mathbf{y}=\mathrm{enc}_{1}(\mathbf{x})$ denote an encoder that is able to encode the binary input string $\mathbf{x}=(x_{1},x_{2},...,x_{239})\in\{0,1\}^{239}$ into $\mathbf{y}=(y_{1},y_{2},...,y_{248})\in\{0,1\}^{248}$ satisfying $\sum_{1\leq i\leq 248}i\cdot y_{i}\equiv 0\pmod{496}$. The $y_{p}$’s, $\forall p\in P_{1}$ serve as redundancy, and the other bits in $\mathbf{y}$ are information bits corresponding to those in $\mathbf{x}$ one by one. During the encoding, the input string $\mathbf{x}=(x_{1},x_{2},...,x_{478})\in\{0,1\}^{478}$ was segmented into two strings $\mathbf{x}_{o}=(x_{1},x_{3},...,x_{477})$ and $\mathbf{x}_{e}=(x_{2},x_{4},...,x_{478})$. This was followed by inputting $\mathbf{x}_{o}$ and $\mathbf{x}_{e}$ into the $\mathrm{enc}_{1}$ to derive $\mathbf{y}_{o}$ and $\mathbf{y}_{e}$, respectively. Subsequently, $\mathbf{y}_{o}$ and $\mathbf{y}_{e}$ were recombined inversely to the original segmentation to conclude the encoding.

In Scheme 2, 2 nucleotides were added as redundancy. Similar as in Scheme 1, denote $P_{2}=\{247,248\}$ and let $\mathbf{y}=\mathrm{enc}_{2}(\mathbf{x})$ represent an encoder than can encode the quaternary input string $\mathbf{x}=(x_{1},x_{2},...,x_{246})\in\{0,1,2,3\}^{246}$ into $\mathbf{y}=(y_{1},y_{2},...,y_{248})\in\{0,1,2,3\}^{248}$ satisfying $\oplus_{1\leq i\leq 248,i\equiv 0\pmod{2}}y_{i}=0$ and $\oplus_{1\leq j\leq 248,j\equiv 1\pmod{2}}y_{j}=0$. The $y_{p}$’s, $\forall p\in P_{2}$ serve as redundancy, while the others in $\mathbf{y}$ are information bits corresponding to those in $\mathbf{x}$ one by one. During the encoding phase, the input string $\mathbf{x}=(x_{1},x_{2},...,x_{246})\in\{0,1,2,3\}^{246}$ was sent into the $\mathrm{enc}_{2}$ and the corresponding output was regarded as the encoding result.

Strings in both schemes were characterized by two syndromes. For the received string without two zero syndromes, it was not identified as a codeword. To recover the received sequence with one edit error, the decoder was able to find all the potential codewords within one edit distance in an exhaustive manner. Assuming the received non-codeword $\mathbf{y}$ has length $m^{\prime}$ and the original codeword has length $n^{\prime}$, there are three scenario: (1) If $m^{\prime}=n^{\prime}+1$, each nucleotide is deleted and the result is checked whether form a codeword. (2) If $m^{\prime}=n^{\prime}$, each nucleotide is transformed into other three nucleotides and the output is checked for codeword formation. (3) If $m^{\prime}=n^{\prime}-1$, a nucleotide is inserted in each position and the resulting string is evaluated for codeword formation. If $m^{\prime}<n^{\prime}-1$ or $m^{\prime}>n^{\prime}+1$, it is trivial to know that more that one edit errors occur, thereby beyond the error-correction capability of the code. It is noteworthy that it has been proven in [23] that the construction in Scheme 1 is able to correct one edit error.

As for the “decoding” clustering strategy, originally proposed in [20], a list was generated for each string within a cluster. This list contained the codewords with the minimal edit distance to the string. Specifically, if the string formed a codeword, the list only contained itself, otherwise, it contained all potential codewords within one edit distance according to the scenario illustrated above (could be empty). After that, the unique codeword that appeared most frequently across the lists was taken as the decoding result, otherwise, there was no decoding result.

4.4 Modified-BFA

The BFA is proposed for decoding fountain code in DNA-based data storage. Unlike the SGE, the BFA is capable of handling the erroneous received strings. The central idea behind the BFA is to assess the reliability of each string by the frequency of involvement in the linear representations. We refer to [19] for further details.

The modified-BFA decoder started by prioritizing all the strings according to the following criteria: (1) Strings in $\mathbf{H}_{p}$ (Section 4.1) took precedence over others. This was because the $\mathbf{H}_{p}$ was known to both the sender and receiver. (2) Among other strings, those with higher read numbers were prioritized. (3) When read numbers were identical, those with the greater hamming weight (i.e., the number of ones) on the $g_{i}$ part were ranked higher.

After that, the BFA was performed according to the established ranking. Strings with higher reliability were chosen out and conducted further decoding.