An Empirical Study of Scaling Laws for Transfer

Abstract

We present a limited empirical study of scaling laws for transfer learning in transformer models. More specifically, we examine a scaling law that incorporates a “transfer gap” term, indicating the effectiveness of pre-training on one distribution when optimizing for downstream performance on another distribution. When the transfer gap is low, pre-training is a cost-effective strategy for improving downstream performance. Conversely, when the gap is high, collecting high-quality fine-tuning data becomes relatively more cost-effective. Fitting the scaling law to experiments from diverse datasets reveals significant variations in the transfer gap across distributions. In theory, the scaling law can inform optimal data allocation strategies and highlights how the scarcity of downstream data can bottleneck performance. Our findings contribute to a principled way to measure transfer learning efficiency and understand how data availability affects capabilities.

1 Introduction

In recent years, a number of papers have uncovered machine learning scaling laws—defined as empirical regularities that describe how the performance of a model increases as a function of scale, usually in parameter count and data ([hestness2017deep], [kaplan2020scaling], [hoffmann2022training]). [hernandez2021scaling] described scaling laws for transfer learning, showing how the transfer learning properties of models change as a function of model size. The primary result was that the degree of transfer—as measured by the amount of effective data transferred from one distribution to another—follows a simple power law in parameter count and fine-tuning data size. However, their analysis left much room for further exploration, as it only considered transfer learning from English to Python, and did not explore the relationship between the pre-training data size and the degree of downstream transfer learning.

Scaling laws for transfer are important to study because they inform the degree to which progress in machine learning is bottlenecked by data for specific tasks. Consider that to achieve high performance on some tasks, one standard approach in the foundation model paradigm is to pre-train a model on a large, diverse distribution and then fine-tune it on a particular downstream task ([bommasani2022opportunities]). An alternative approach to fine-tuning for adapting pre-trained language models to downstream tasks is in-context learning, where a model is given a sequence of demonstrations within a prompt ([brown2020language], [mosbach2023fewshot]). The effectiveness of these approaches depends on the degree of knowledge transfer from the pre-trained model to the downstream task or distribution. If the degree of transfer is high, then the cost of fine-tuning is typically low, allowing foundation models to efficiently learn to perform well on downstream tasks with minimal fine-tuning data. Conversely, if the degree of transfer is low, then performance is more heavily dependant on the amount of high-quality fine-tuning data available, motivating the curation of large fine-tuning datasets.

To help study whether high-quality fine-tuning data might bottleneck performance on important tasks, we devised a simple framework for measuring the transfer gap between two distributions using scaling laws for transfer. In this article, we loosely define the transfer gap as the maximum theoretical benefit of pre-training, achievable in the limit of infinite pre-training data. More specifically, the transfer gap is a quantity that emerges from an empirical scaling law for transfer when evaluating the limit of the scaling law as the pre-training variable tends towards infinity. By empirically comparing the predictive validity of various functional forms, we have settled on the following scaling law for transfer, where $p$ represents the number of pre-training steps and $f$ represents the number of fine-tuning data points.

$$L(p,f)=\left(\underbrace{A\cdot p^{-\alpha}}_{\text{Pre-training term}}+\underbrace{G}_{\text{Transfer gap}}\right)\cdot\underbrace{f^{-\beta}}_{\text{Fine-tuning term}}+\underbrace{E}_{\text{Irreducible loss}}$$ (1)

In this scaling law, taken from [mikami2021scaling], the transfer gap determines the efficiency of fine-tuning in the limit of infinite pre-training data. By measuring the transfer gap from inexpensive and abundant pre-training distributions to costly downstream distributions, we can predict how much pre-training might improve performance on a given downstream distribution. Thus, measuring the transfer gap across various tasks can meaningfully inform the relative difficulty of automating downstream tasks, although drawing firm conclusions about the difficulty of automation is premature given the limited data in this study.

Our study relies heavily on the Pythia model suite ([biderman2023pythia]), providing a large set of transformer models trained on the Pile at various model sizes and checkpoints during training. We fine-tune a 2.8 billion parameter model on various downstream language datasets, including a mathematics dataset, a genetic sequence dataset, a statistics textbook, and a synthetic dataset of fictional biographies within a procedurally generated universe. After fitting the scaling law to empirical data, we demonstrate how this scaling law can be used to answer concrete questions, such as “How valuable is it to collect more fine-tuning data for a given task, compared to scaling up pre-training data?” and “What is the transfer gap from one distribution to another?”.

Our analysis is incomplete for several reasons. Firstly, we do not derive a scaling law in model size. Secondly, our results are largely limited to language datasets and were obtained with a relatively modest compute budget. For these reasons, we cannot necessarily extrapolate these results to much larger model sizes, of the type that exist at the current commercial frontier (e.g. [openai2024gpt4], [geminiteam2024gemini]). Nonetheless, we hope our study can serve as a limited foundation for further research, stimulating more investigations into empirical scaling laws for transfer learning, enhancing our understanding of the role of data in advancing AI progress, and providing deeper insights into the difficulty of automating various economically important tasks.

2 Related work

Neural scaling laws The modern study of neural scaling laws began with [hestness2017deep], who observed a power law relationship between data size and error across image, language, and speech domains. Similarly, [rosenfeld2019constructive] identified a power law relationship involving both model size and data. The work of [kaplan2020scaling] and [hoffmann2022training] furthered this research in language modeling, emphasizing the implications for allocating compute budgets—a tradition we continue in this study.

[hernandez2021scaling] studied scaling laws for transfer in model size and fine-tuning data. Unlike their study, ours differs in three key ways. First, our study examines pre-training steps and fine-tuning data. Second, rather than studying the effective data transferred, our study directly investigates how test loss varies as a function of training inputs. These distinctions are crucial because they allow us to directly estimate the “transfer gap” between two distributions, enabling a more fine-grained analysis of the limits to pre-training. Finally, we examine transfer across multiple diverse datasets, not just from English to Python.

Another similar study is [mikami2021scaling], which investigated how pre-training data affects transfer properties, similar to our approach. Unlike their study, ours involved training models to convergence on the fine-tuning data but not on the pre-training data, which we believe is a more realistic assumption in the large-data regime. Their research also focused on image classification, whereas ours is focused on natural language processing. Moreover, we aim to measure the “transfer gap” between various distributions more directly and show how these gaps inform economic trade-offs when training large machine learning models, an aspect not addressed by [mikami2021scaling]. Nonetheless, we borrow the scaling law form from [mikami2021scaling], which they postulated through theoretical analysis. For convenience and transparency, we detail how this scaling law can be derived in Appendix A.

While our study focuses on transfer learning scaling laws between language datasets, [aghajanyan2023scaling] investigated scaling laws for generative language models trained on multiple modalities. They modeled the individual contributions and interactions between modalities, identifying regimes of competition and synergy, where training on multiple modalities either negatively or positively affected performance, respectively. Although their study analyzed a distinct scenario—training on multiple modalities during pre-training, rather than pre-training on one dataset and fine-tuning to convergence on another—their study complements ours through the use of scaling laws across different datasets. The interaction terms in [aghajanyan2023scaling]’s scaling law suggest transfer between datasets, which we attempt to quantify precisely using our framework.

In contrast to this study, [zhang2024scaling] compared full-model tuning (FMT) with parameter-efficient tuning (PET). Their findings from experiments on bilingual LLMs suggested a multiplicative scaling law between fine-tuning data and other factors, indicating that model scaling offers more benefits than scaling pre-training data, with PET showing limited effectiveness. By comparison, our study exclusively employs full-parameter tuning for all experiments.

A review of the neural scaling law literature can be found in [epoch2023scalinglawsliteraturereview]. The scarcity of previous work on scaling laws for transfer learning highlighted in their review further accentuates the need for research in this area.

Transfer learning Broadly speaking, the concept of transfer learning has been ubiquitous in machine learning. Most relevant to this study is its function as the key concept underpinning foundation models ([bommasani2022opportunities]). Transfer learning involves taking knowledge learned on one task and applying it to another. This approach has been successfully used to build highly versatile language models that are pre-trained on large corpora and fine-tuned to perform well on various downstream tasks, with examples including [openai2024gpt4], [geminiteam2023gemini], and [jiang2024mixtral]. An early exploration of this concept was provided by [raffel2023exploring], which informed subsequent work.

Theoretical investigations of transfer learning have been explored by [Baxter_2000], [maurer2016benefit], and [tripuraneni2020theory]. These papers generally attempt to explain transfer learning by appealing to the concept of representation learning. In effect, when a model learns a representation from a pre-training distribution shared by downstream tasks, it enables the model to learn these tasks with fewer data points. While these studies provide valuable insights into the mechanisms behind transfer learning, it is challenging to directly apply these insights to derive a scaling law for transfer learning in a manner that would be most directly applicable to the present study. Nevertheless, these studies are useful for analyzing the convergence behavior of models in a transfer learning setting. For example, [maurer2016benefit] proposes a framework for bounding the convergence rate of a learning algorithm depending on the number of samples from the pre-training task ($p$) and the downstream task ($f$), which follows a power law of the form $O(p^{-1/2})+O(f^{-1/2})$.

3 The scaling law for transfer

We investigate scaling laws for transfer learning using a 2.8 billion parameter transformer model from the Pythia suite of models ([biderman2023pythia]). Specifically, we attempt to fit a scaling law to empirical data that relates cross-entropy loss on the fine-tuning distribution to the number of pre-training tokens seen, denoted $p$, and the size of fine-tuning data, denoted $f$. In this article, we refer to this mathematical relationship as a scaling law for transfer.

Considering a number of potential scaling law forms, we identified one that was both simple and appeared to perform well according to empirical tests. This form was taken directly from [mikami2021scaling], and serves as the basis of the analysis presented here:

$$L(p,f)=(A\cdot p^{-\alpha}+G)\cdot f^{-\beta}+E$$ (2)

This scaling law is composed of four distinct terms. The first term, $A\cdot p^{-\alpha}$, is the pre-training term: a power law in pre-training data steps. The second term is the transfer gap, $G$. The utility of the transfer gap can be seen by considering $\lim_{p\to\infty}L(p,f)$. In the infinite pre-training regime, the only value remaining inside the parentheses is the transfer gap, implicitly setting the ultimate efficiency of transfer learning from the pre-training distribution to the fine-tuning distribution. The third term, $f^{-\beta}$, is the fine-tuning term, which is a power law. Finally, the fourth term, $E$, represents the intrinsic entropy of the fine-tuning distribution, setting the maximum theoretical limit of training performance.

We compare this scaling law to the scaling law proposed by [hernandez2021scaling] and discuss how it can be derived in Appendix A. It is important to note that there are a large number of potential forms that we did not consider. Consequently, it is highly plausible that different functional forms for the scaling law might better predict the data. Several lines of research have aimed at uncovering the theoretical underpinnings of scaling laws in machine learning (see, for example, [sharma2020neural] and [bahri2021explaining]), but as of this writing, we do not have sufficient confidence in any theoretical framework to definitively derive the “correct” form of the scaling law for transfer in our analysis. For these reasons, we rely more on empirical tests to demonstrate the robustness of fit.

To compare various potential scaling law forms against each other, we employ a form of cross-validation as described in subsection 4.3 that enables us to test how well the model predicts data out-of-distribution. We also compute goodness-of-fit statistics using bootstrapping.

4 Methods

4.1 Datasets

To empirically measure the transfer learning properties of transformer models, we fine-tuned them on five datasets: four diverse language datasets and one biological sequence dataset. One of the language datasets was a synthetic dataset designed to be subtly different from any natural dataset, to test whether the resulting scaling law for transfer uncovered genuine transfer to novel distributions. The other three language datasets were naturally collected. Two of the language datasets (the math arXiv and statistics textbook datasets) contain data that was published after the creation of the Pile, and thus are highly unlikely to be contained in the pre-training dataset. By contrast, the Enron emails dataset ([enron_dataset]) is documented to have been included in the Pile ([biderman2023pythia]). Finally, the genomic dataset ([felis_catus_9_ensemble]) was selected to determine whether we could uncover the transfer learning gap to very distant distributions. More details for all of these datasets are outlined in Table 1. A longer description and sample from each dataset can be found in Appendix F.

Dataset Name	Source	Type	Description
Fictional encyclopedia	Synthetic	Natural language	Generated by GPT-3.5 to simulate biographies in a fictional universe, specifically designed to test scaling laws for transformer models.
Math arXiv	Collected	Natural language	Consists of recent mathematics papers from the arXiv database, parsed in LaTeX format (uploaded after knowledge cutoff).
Statistics textbook	Collected	Natural language	Derived from “Statistics for Ecologists” focusing on modern regression methods, includes both frequentist and Bayesian approaches, open-source.
Enron emails	Collected	Natural language	Comprises a subset of the well-known Enron email dataset, providing a rich source of real-world corporate email communication data.
House cat genome	Collected	Genomic data	Consists of the sequenced genome of a domestic cat, used for biological and genetic research.

Table 1: Datasets used for fine-tuning the large language models

4.2 Training

All models were part of the Pythia suite of transformer models, pre-trained on the Pile ([gao2020pile], [biderman2023pythia]). Specifically, we selected 15 checkpoints during the training of a 2.8 billion parameter model from the Pythia suite. These checkpoints were saved at various stages during training, with the final checkpoint occurring at 143,000 steps and a batch size of 2,097,152 tokens. For each of these 15 checkpoints, and across each dataset, we conducted 15 experiments by fine-tuning the model to convergence on subsets of the datasets, with sizes ranging from 10 to 1,100 tokens and a context length of 256, employing full-parameter fine-tuning ([raffel2023exploring]).

We trained to convergence on the fine-tuning data because we believe this procedure captures the intuitive idea of learning as much as possible from limited fine-tuning data, which we believe is most relevant for studying how to optimize performance when downstream data is scarce. The number of pre-training steps and number of fine-tuning data points for all of the experiments are summarized in Table 4. During fine-tuning, we update all model parameters and did not explore parameter-efficient fine-tuning methods such as LoRA ([hu2021lora]), which we suggest as a direction for future research.

The models were trained on an H100 GPU, utilizing a batch size of 10, and employing gradient accumulation steps of 25. The optimizer of choice was AdamW, configured with a learning rate of $1\times 10^{-5}$, betas of 0.9 and 0.999, an epsilon value of $1\times 10^{-8}$, and no weight decay. These models were trained to convergence on each subset of every fine-tuning dataset with an early stopping patience of 3, resulting in a total of 750 training runs across all of our experiments.

4.3 Scaling law evaluation

To better understand the robustness of the scaling law, we conducted a form of step-wise cross-validation on the data to test its out-of-distribution predictive abilities. The step-wise cross-validation process involves selecting a set of thresholds for each input variable: pre-training tokens seen, and fine-tuning data size. All possible combinations of these thresholds are then generated. For each combination, the data is split into a training set containing data points below the threshold values and a testing set containing data points above the threshold values. The scaling law is then fitted to the training set and evaluated on the testing set, assessing how well it predicts data points that were not included in the training phase.

By iterating over all combinations of thresholds and assessing the scaling law’s performance on data points outside the range used for fitting, this process helps to assess the model’s ability to generalize and make accurate predictions about language models trained with more pre-training steps or more fine-tuning data points. This step-wise cross-validation process is outlined in Appendix D and is visually summarized in Figure 7. Additionally, for each general scaling law, we employ L2 regularization, with a set of different hyperparameter choices for each scaling law variant. More details about the choice of regularization hyperparameters are provided in Appendix D.

5 Results

Here, we provide an overview of some key general results from the empirical study. However, an in-depth presentation of the experimental data can be found in Appendix B.

5.1 Pre-training acts to reduce loss relatively independently from the transfer gap

Table 2 presents the empirically fitted parameter values of the scaling law for transfer on each dataset. Recall that the key equation we fit is:

$$L(p,f)=\left(\underbrace{A\cdot p^{-\alpha}}_{\text{Pre-training term}}+\underbrace{G}_{\text{Transfer gap}}\right)\cdot\underbrace{f^{-\beta}}_{\text{Fine-tuning term}}+\underbrace{E}_{\text{Irreducible loss}}$$ (1)

Comparing these values across datasets reveals some interesting patterns. The exponent in the pre-training term, $\alpha$, exhibited relatively low variation compared to the other terms, across the different fine-tuning datasets. More specifically, the coefficient of variation for the pre-training exponent, $\alpha$, was found to be less than 25% of that for the fine-tuning exponent, $\beta$, across the fine-tuning datasets. The coefficients of variation across datasets for all parameters are shown in Table 2.

These results suggest a consistent contribution to the reduction of loss from pre-training that occurs independently of the transfer gap $G$. Since the degree of downstream transfer is mediated by the pre-training and transfer gap terms, this result strengthens the interpretation of the transfer gap as representing the directed proximity between two different distributions.

Table 2: Fitted parameter values for the fine-tuning datasets, with standard errors shown in parentheses

Dataset $A$ $G$ $\alpha$ $\beta$ $E$ Fictional encyclopedia 284.766 (38.55) 2.570 (0.18) 0.730 (0.02) 0.123 (0.01) 0.538 (0.19) Math arXiv 317.966 (29.31) 0.166 (0.04) 0.756 (0.02) 0.059 (0.01) 1.758 (0.04) Statistics textbook 177.321 (20.93) 1.305 (0.26) 0.627 (0.02) 0.126 (0.02) 1.367 (0.19) Enron emails 181.482 (19.32) 0.595 (0.11) 0.611 (0.02) 0.159 (0.01) 1.373 (0.07) House cat genome 43.556 (7.85) 0.548 (0.02) 0.718 (0.05) 0.228 (0.03) 2.677 (0.04) Coefficient of variation 0.528 0.851 0.094 0.432 0.490

Contrary to our initial expectations, the transfer gap for the house cat genome dataset was relatively small, estimated to be only $0.548$, despite the fact that it was not a natural language dataset, and thus should intuitively be expected to have a low degree of transfer (and thus a large transfer gap). However, we believe this result can be reconciled with our intuitions by considering the relatively high estimated irreducible loss for the house cat genome dataset, at $2.677$, indicating that the dataset has high intrinsic entropy, and relatively little learnable structure.

Given the interpretation of the transfer gap, $G$, as indicating the maximum theoretical benefit of pre-training, it is unsurprising that this quantity would be low when fine-tuning on a dataset with little learnable structure. In a trivial case, fine-tuning on a dataset of random digits would likely exhibit a high degree of transfer learning, since the model only needs to learn the general pattern of random digit generation in order to achieve optimal downstream performance. It seems likely that such a simple underlying structure in the fine-tuning data could be easily picked up in the limit of maximum pre-training.

5.2 The scaling law for transfer can be efficiently estimated using relatively little compute

Despite only utilizing 150 data points per dataset, we have obtained a fairly robust fit for the scaling law on each dataset, as indicated by the relatively narrow confidence intervals for each parameter. Specifically, the standard error for the exponent parameters generally ranged between $0.01$ and $0.03$. By comparison, the standard errors for the exponent parameters in the scaling law in [hoffmann2022training] was around $0.02$, indicating a similar degree of uncertainty ([besiroglu2024chinchilla]). These intervals were derived from bootstrapping with 4,000 samples per dataset, and the results are shown in Table 3. The standard errors for all of the parameters are detailed in Table 2.

To estimate the necessary compute to run our full set of experiments, we can employ the heuristic that $\text{Compute}={6\cdot N\cdot D}$ where $N$ is the number of parameters in the model, and $D$ is the number of tokens seen during a single epoch ([kaplan2020scaling], [hoffmann2022training]). Since there were 750 training runs in total, we can use the following formula:

$$\text{Estimated compute}=6\cdot\sum_{t\in T}(\text{Epochs until convergence for $t$})\cdot N\cdot D_{t}$$ (3)

where $T$ represents the set of all training runs. Using this formula, we get $\text{total estimated compute }\approx 4.77\cdot 10^{16}\text{ FLOP}$. To put this number in perspective, it is less than one millionth the estimated compute used to train Meta’s Llama 3 70B ([llama3modelcard], [epoch2023pcdtrends]). This estimate underscores the potential to obtain better estimates of the parameters in scaling laws for transfer using very little compute. These laws can, in turn, can inform data allocation strategies for larger training runs.

Table 3: 95% Confidence intervals for bootstrapped parameters

Dataset $A$ $G$ $\alpha$ $\beta$ $E$ Fictional encyclopedia [227.69, 378.80] [2.34, 3.05] [0.684, 0.781] [0.096, 0.151] [0.05, 0.81] Math arXiv [258.27, 373.16] [0.00, 0.17] [0.719, 0.788] [0.038, 0.070] [1.72, 1.89] Statistics textbook [132.82, 214.86] [0.95, 1.98] [0.594, 0.658] [0.086, 0.148] [0.83, 1.59] Enron emails [129.67, 205.41] [0.44, 0.86] [0.576, 0.641] [0.118, 0.176] [1.18, 1.46] House cat genome [13.41, 44.17] [0.52, 0.60] [0.567, 0.780] [0.148, 0.274] [2.58, 2.72]

6 Discussion

6.1 Trading off pre-training and fine-tuning data collection

Figure 1: This plot presents the trade-offs between expanding pre-training and collecting more fine-tuning data to achieve low loss on the synthetic fictional encyclopedia dataset. The isolines, or lines of equivalent loss values, delineate the points at which equal loss is achievable given different combinations of pre-training steps and fine-tuning data points. The plot demonstrates that at low pre-training values, significant benefits can be gained from both increasing fine-tuning data and expanding pre-training. Conversely, at high pre-training values, the marginal benefit of additional pre-training diminishes, making the collection of more fine-tuning data points increasingly valuable for reducing loss.

Consider a situation where there are costs associated with fine-tuning data collection, and we have a fixed budget, which can be allocated to either scaling pre-training or collecting more fine-tuning data. By utilizing the scaling law for transfer, we can determine under which circumstances it is valuable to collect more data or scale pre-training.

Consider the simplest case where one is optimizing for performance on only a single downstream distribution. Let $B$ represent the budget, $C_{p}$ the cost of a single pre-training step, and $C_{f}$ the cost of collecting a fine-tuning datapoint and training on it (all in dollars). Given this setup, the optimal allocation of spending on pre-training and fine-tuning for a model of fixed size is given by the solution to the following optimization problem:

$$\underset{p,f}{\text{minimize}} L(p,f)$$ (4)

subject to $$C_{p}\cdot p+C_{f}\cdot f\leq B,$$

If we assume the fitted scaling law found for the synthetic encyclopedia dataset, with only the transfer gap varying, Figure 2(a) illustrates how the optimal budget allocation on fine-tuning data evolves as the transfer gap $G$ grows larger. When $G$ is low, it is more cost-effective to allocate the budget primarily to scaling pre-training. Conversely, when $G$ is high, it becomes more advantageous to allocate the budget predominantly to collecting fine-tuning data. This dynamic can be interpreted as indicating that pre-training is more cost-efficient when the transfer between distributions is low, underscoring the strategic importance of understanding the transfer gap when allocating training resources.

(a) Budget allocation vs. transfer gap $G$.

(b) Budget allocation vs. cost ratio $C_{f}/C_{p}$.

Figure 2: The plots illustrate how the optimal budget allocation between pre-training and fine-tuning, $p$ and $f$, evolves under different conditions. Plot (a) shows the relationship as the transfer gap from the pre-training distribution to the fine-tuning distribution $G$ increases, where initially the budget is largely allocated towards pre-training ($p$), but as $G$ rises, the allocation shifts significantly towards fine-tuning ($f$). Plot (b) illustrates the budget allocation for fine-tuning data ($f$) as the ratio of the cost per fine-tuning data point to the cost per pre-training step ($C_{f}/C_{p}$) increases. Initially, the allocation towards fine-tuning ($f$) is higher, but as the cost ratio ($C_{f}/C_{p}$) increases, the budget allocation for pre-training ($p$) also increases, reflecting the impact of cost ratio on budget optimization for a fixed transfer gap.

We can also consider a situation in which we fix the transfer gap, and examine the effect the relative cost between $C_{f}$ and $C_{p}$. 2(b) illustrates how the optimal ratio of spending on fine-tuning evolves when the relative cost of fine-tuning data increases, when fixing the scaling law for transfer fit to the fictional encyclopedia dataset (including fixing the transfer gap).

Our results imply that extensive pre-training—a hallmark of the foundation model paradigm—is particularly advantageous when the transfer gap is low. When the transfer gap is low, pre-training is cost-efficient, meaning that optimally allocating the budget between pre-training and fine-tuning data to maximize downstream performance primarily involves allocating the budget towards pre-training, at least when pre-training data is cheap.

Both [mikami2021scaling] and [hernandez2021scaling] found that scaling model size improved the degree of transfer. In our framework, this could potentially manifest as a decreasing transfer gap with increasing model scale, although we did not investigate the effect of model size on the transfer gap in this study. Speculatively, it is plausible that model scaling robustly decreases the transfer gap, explaining why pre-training seems to be so effective in the large model regime. We encourage future work on scaling laws for transfer to investigate this hypothesis.

6.2 The transfer gap can set the difficulty of achieving high performance in novel domains

On first approximation, the difficulty of training a model to perform well on a task appears to be primarily determined by the task’s intrinsic complexity. However, the field of natural language processing presents a compelling counterexample. Despite the vast, inherent complexity of natural language, significant developments have been made in automating classic NLP tasks, such as translation and classification, through the development and application of large language models. We think this progress can largely be explained by the vast amount of natural language data freely available on the internet, which has enabled the training of these models on an unprecedented scale. The success in automating NLP tasks suggests that the availability of abundant, relevant training data can help overcome the challenges posed by intrinsically complex tasks.

In domains where data is less abundant, such as general-purpose robotics, we speculate that the difficulty of achieving high-performance in these domains may be significantly influenced by the transfer gap from a cheap, abundant pre-training distribution to the downstream task of interest. This is because, although collecting fine-tuning data can be expensive, it may be feasible to leverage transfer learning from much cheaper pre-training distributions with additional model scaling. Indeed, roboticists have identified the hardness of effective sim2real transfer as a key difficulty in making progress in robotics (see, for example, [weng2019DR]).

Given that our framework enables the direct measurement of the transfer gap, we believe it can be a valuable tool for estimating the difficulty of achieving high performance on tasks in various domains. By quantifying the transfer gap between cheap, abundant pre-training data (such as internet text data) and the target task data, researchers can gain insights into the potential challenges and feasibility of achieving high performance on specific tasks using machine learning. This information can help guide decisions on resource allocation, such as whether to focus on collecting more task-specific data or investing in larger-scale pre-training. Ultimately, understanding the transfer gap may be key to unlocking progress in domains where data scarcity has been a significant barrier to performance.

7 Conclusion

In this study, we presented an empirical analysis of scaling laws for transfer learning in transformer language models. By fitting a scaling law that incorporates terms for pre-training data and fine-tuning data size, we were able to measure the degree of transfer from pre-training to various downstream distributions. This scaling law provided a good fit across several language datasets, and reveals significant variation in the magnitude of the transfer gaps.

A key positive result was that the standard errors for all parameter estimates were relatively tight, even though we used only 150 data points per fine-tuning dataset. Given that we achieved useful results without significant computing resources, we believe that our study has illustrated the potential for using scaling laws for transfer to precisely measure the transfer gap between distributions, even without expensive computing setups.

Our work has important implications for the development of foundation models and achieving higher performance on complex tasks. When the transfer gap is sufficiently small, pre-training can become a highly cost-effective strategy for enhancing downstream performance. Conversely, for tasks with large transfer gaps, focusing resources on curating fine-tuning data may be more impactful. By accurately measuring transfer gaps across a wide range of domains, we can develop a clearer picture of the relative difficulty of achieving high performance on different tasks using deep learning and guide resource allocation accordingly.

However, we also caution against interpreting these results too broadly. Since we did not examine the effect of model scale or model architecture on scaling laws for transfer, it is not straightforward to apply these scaling laws to models in completely different contexts. While we hope that this strand of research can be useful for helping researchers allocate resources between pre-training and fine-tuning to achieve high downstream performance, a more complete investigation is needed before this work can be applied directly to many applications.

Appendix A More details about the scaling law for transfer

To speculate the form of the scaling law for transfer, we borrow from [mikami2021scaling], who proposed plausible criteria for such a law, derived from their empirical analysis. It is important to note some key differences between their study and ours: they focused on $L_{2}$ loss in images, whereas our study deals with cross-entropy loss on mainly natural language data. Additionally, their analysis used the number of fine-tuning data points seen as the data variable, in contrast to our use of fine-tuning data size, as we train our models to convergence on the fine-tuning data. Keeping these distinctions in mind, we now revisit the conditions from [mikami2021scaling]:

1. (Irreducible error)

   $$\lim_{{f\to\infty}}L(p,f) =E$$

2. (Power law with maximum pre-training)

   $$\lim_{{p\to\infty}}L(p,f) =G\cdot f^{-\beta}+E$$

3. (Power law with no pre-training)

   $$L(0,f) =C\cdot f^{-\beta}+E$$

In addition to the three conditions from [mikami2021scaling], we introduce a fourth condition, which enhances our interpretation of the transfer gap:

1. (Power law plus transfer gap with no fine-tuning)

   $$L(p,0) =A\cdot p^{-\alpha}+G+E$$

Conditions 2, 3, and 4 are natural assumptions given that the power law form is ubiquitous in machine learning scaling laws ([henighan2020scaling], [sharma2020neural], [villalobos2022run]). The empirical strength of the power law form is evidenced by the clear power law-like shape observed in the data. This shape is illustrated by Figure 3, which reveals how loss decreases in pre-training steps, for a fixed number of fine-tuning data points.

Figure 3: This plot illustrates a cross-section of the fitted scaling law to the data for the fictional encyclopedia dataset, illustrating both clear transfer learning, and that the power law form provides a good fit in pre-training data steps. This empirical observation confirms our intuitions that the scaling law for transfer should reduce to a power law under various conditions. These conditions are detailed in Appendix A

.

Given the first three conditions, [mikami2021scaling] speculate the following form, which is not the only possible form that satisfies these four conditions:

$$L(p,f)=(G+A\cdot p^{-\alpha})\cdot f^{-\beta}+E$$ (5)

$$=A\cdot p^{-\alpha}\cdot f^{-\beta}+G\cdot f^{-\beta}+E$$ (6)

Here, $p$ refers to the pre-training data steps, and $f$ refers to the fine-tuning data size, with $A,G,E,\alpha,\beta$ representing the constants in the scaling law, which are determined empirically by fitting the model to data. As previously noted in section 3, this scaling law is technically an approximation of the true scaling law, in which the terms $p$ and $f$ are modified to $p-1$ and $f-1$ respectively. This adjustment is necessary to ensure that conditions 3 and 4 of the scaling law are satisfied.

$$L(p,f)=(A\cdot(p+1)^{-\alpha}+G)\cdot(f+1)^{-\beta}+E$$ (7)

[mikami2021scaling] support their speculation with a theoretical analysis of the evolution of loss during training within the Neural Tangent Kernel (NTK) framework, building on the work of [arora2019finegrained] and [nitanda2020gradient]. However, their theoretical analysis is not directly applicable to the present study, as our fine-tuning data term, $f$, represents the number of fine-tuning data points, rather than the number of steps during training. Consequently, the NTK framework has limited applicability to our analysis.

Instead of relying on theory to justify the scaling law form represented by Equation 5, we utilize empirical analysis. Specifically, we explored many alternative plausible forms for the scaling law that satisfy at least some of these four conditions, and rigorously tested their ability to predict our experimental data via extensive cross-validation, as described in Appendix D.

Despite the various forms we considered, none substantially improved upon the simple form proposed by [mikami2021scaling], lending credence to the idea that this form is relatively robust. Given the form’s simplicity and good performance, it is the primary form we employed to demonstrate our results.

A.1 Comparing to [hernandez2021scaling]

It is useful to contrast our scaling law form with that in [hernandez2021scaling]. In their study, they define $D_{T}$, for effective data transferred, as the amount of additional fine-tuning data that a model of the same size trained only on fine-tuning data would have needed to achieve the same loss on fine-tuning data as a model trained purely on pre-training data. This concept is given by the following equation:

$$D_{T}=\text{effective data transferred}=k(D_{F})^{\alpha}(N)^{\beta}$$ (8)

where $N$ is the number of non-embedding parameters, and $D_{F}$ is the size of the fine-tuning data. To compare this scaling law with the one from [mikami2021scaling], we can derive a notion of effective data transferred using (5) by solving the following equation for $f_{2}$:

$$L(p,f_{1})=L(0,f_{2}),$$ (9)

which indicates that the value for $f_{2}$ is such that we achieve the loss $L(p,f_{1})$ without any pre-training data. Recall that $p=\text{pre-training tokens seen}+1$.

$$(G+A\cdot p^{-\alpha})\cdot f_{1}^{-\beta}+E=(G+A)\cdot f_{2}^{-\beta}+E$$ (10)

$$f_{2}=\left(\frac{f_{1}^{\beta}\cdot(A+G\cdot p^{-\alpha})}{A+G}\right)^{\frac{1}{\beta}}$$ (11)

Given the complexity of this functional form, we prefer to refer to Equation 5 directly as a function of pre-training data processed and fine-tuning datapoints, rather than in terms of effective data transferred as considered by [hernandez2021scaling].

Appendix B A presentation and analysis of the empirical data

A selection of in-depth results from the experiments is presented in this section. A basic presentation of the data is shown in Figure 5. Model performance across varying pre-training steps and fine-tuning data sizes demonstrates clear transfer learning across all datasets, as evidenced by the smoothly decreasing loss with increasing pre-training data for all datasets, with the notable exception of the house cat genome dataset. This dataset exhibits a more erratic pattern compared to the others, likely reflecting its significant dissimilarity to the pile.

Figure 4: Validation loss compared against the predicted values of the fitted scaling law in three dimensions, in logarithmic space, for the synthetic dataset. From visual inspection, the scaling law appears to be a close fit for the data, fitting the shape of the data points, and showing no obvious signs of overfitting.

(a) Fictional encyclopedia raw data.

(b) Math arXiv raw data.

(c) Statistics textbook raw data.

(d) Enron emails raw data.

(e) House cat genome raw data.

Figure 5: Cross entropy loss as a function of pre-training data steps and fine-tuning data points across all datasets in the study. The plots show clear transfer learning, with decreasing loss with increasing pre-training values. The math arXiv dataset shows slowly decreasing loww from fine-tuning relative to pre-training, reflected in the scaling law by a relatively small fine-tuning exponent. The housecat genome data displays the most erratic and unclear pattern, likely reflecting instability caused from the high dissimilarity of this dataset from the pre-training data.

Figure 4 illustrates how well the scaling law (Equation 5) fits the experimental data from the fictional encyclopedia dataset, in a 3D plot. Through close visual inspection, it is clear that the underlying structure of the data is well-modeled by the fitted scaling law. In particular, the power law-like relationship in both pre-training steps and fine-tuning data points is well-captured by the scaling law. Given the simple nature of the scaling law, it is unlikely to be overfitting the data significantly. The goodness of fit of this particular scaling law is further validated by the results from cross-validation, outlined in Appendix D.

Finally, Figure 6 illustrates the trade-offs between expanding pre-training and collecting more fine-tuning data across all of the datasets. Comparing these different plots reveals how optimal strategies for allocating data can change depending on the scaling law for transfer. For example, for the math arXiv dataset, pre-training remains a relatively effective strategy for reducing loss for even high levels of pre-training, as indicated by the nearly-vertical iso-lines. By contrast, for the fictional encyclopedia dataset, pre-training is generally highly beneficial in a regime of low pre-training, but becomes relatively less helpful in a regime of high pre-training, as the isolines become closer to being horizontal. This demonstrates how scaling laws for transfer can be used to inform strategies for allocating data and compute when training models.

(a) Fictional encyclopedia iso-loss.

(b) Math arXiv iso-loss.

(c) Statistics textbook iso-loss.

(d) Enron emails iso-loss.

(e) House cat genome iso-loss.

Figure 6: These iso-loss curves illustrate the various ways of achieving identical cross entropy loss using different combinations of training inputs, for each dataset. It is clear that the math arXiv dataset benefits greatly from pre-training relative to fine-tuning, as the iso-loss curves are very steep vertically. By contrast, the fictional encyclopedia dataset benefits greatly from pre-training only in a regime of low pre-training. In a regime of greater pre-training, fine-tuning is a more effective strategy of reducing loss, owing to the nearly horizontal iso-loss curves.

Appendix C More information about the experimental methodology

Tokens seen during pre-training	Fine-tuning data size, in tokens
$5.37\times 10^{8}$	$10$
$1.07\times 10^{9}$	$30$
$2.10\times 10^{9}$	$40$
$4.19\times 10^{9}$	$70$
$6.29\times 10^{9}$	$100$
$1.05\times 10^{10}$	$170$
$1.68\times 10^{10}$	$270$
$2.31\times 10^{10}$	$430$
$3.57\times 10^{10}$	$690$
$5.45\times 10^{10}$	$1100$
$7.97\times 10^{10}$
$1.22\times 10^{11}$
$1.80\times 10^{11}$
$2.73\times 10^{11}$
$2.99\times 10^{11}$

Table 4: This table details the set of training run experiments for each fine-tuning dataset. Every combination of these training settings represents a single experiment, with a total of 150 experiments per fine-tuning dataset, and a total of 750 experiments across all 5 datasets. The list of fine-tuning datasets can be found in Table 1

For each fine-tuning dataset, a set of training runs were performed for the 2.8 billion parameter Pythia model at various pre-training checkpoints. When the model was fit to convergence, the final minimum evaluation loss value was recorded, along with the pre-training tokens seen, fine-tuning data size, and number of epochs until convergence. This comprehensive suite of training runs form the data points used to fit the scaling law for transfer, with each training run representing a single data point. The full set of training runs specifications are provided by Table 4.

C.1 Methodology for fitting the scaling law

To find the parameters presented in Table 2, we employed the BFGS optimization method to solve this minimization problem:

$$\underset{a,g,e,\alpha,\beta}{\text{minimize}}$$ (12)

$$\sum_{\text{run}_{i}}\text{Huber}_{\delta}\bigg{(}\log\left(\exp\left(-\beta\log(f_{i})+\log\left(\exp(a)p_{i}^{-\alpha}+\exp(g)\right)\right)+\exp(e)\right)-\log(L_{i})\bigg{)}$$

where $A=\exp(a),G=\exp(g),E=\exp(e)$. The optimization iteratively refined its estimates, starting from the grid of initial guesses, $a\in\{0.0,2.0,\ldots,8.0\}$, $b\in\{0.0,0.33,\ldots,1.0\}$, $c\in\{-5.0,-3.33,\ldots,5.0\}$, $d\in\{0.0,0.33,\ldots,1.0\}$, and $e\in\{0.0,1.0,\ldots,3.0\}$. We used $\delta=10^{-3}$ for the Huber loss.

Appendix D Comparing the forms of the scaling laws

To evaluate scaling law forms, we employed a form of cross validation which we call step-wise cross-validation. The step-wise cross-validation process involves iterating over various combinations of data thresholds and regularization values, in order to test the ability for the scaling law to predict the performance of models trained on either more pre-training data or on more fine-tuning data points, or both.

This procedure is intended to be a comprehensive form of cross-validation that is less computationally expensive than exhaustive cross-validation, in which all $2^{N}$ possible combinations of training-test splits are considered. Specifically, the procedure is as follows:

1. Threshold Combinations: The dataset is split into training and testing sets based on the threshold combinations. Every skip_number-th combination is used to balance computational efficiency and diversity in data splits.

2. Training and Testing: A model is trained on the training set and evaluated on the validation set. The basinhopping optimization technique is utilized to find the best parameters that minimize the objective function of the scaling law.

3. L2 Regularization for Exponents (Controlled by $\alpha$): This term adds a penalty to the loss function proportional to the sum of squares of the exponent parameters. The regularization strength is controlled by the parameter $\alpha$, which helps prevent overfitting by penalizing large exponent values.

4. L2 Regularization for Coefficients (Controlled by $\beta$): Similarly, this term penalizes the sum of squares of the coefficient parameters, with $\beta$ controlling the regularization strength. It ensures that the coefficients do not become excessively large, which can lead to overfitting.

5. Model Evaluation: The model’s performance is assessed using Root Mean Squared Error (RMSE) and Mean Absolute Error (MAE).

This approach allows for a detailed and thorough investigation of the model’s performance across a wide range of scenarios, ensuring robustness and reliability of the parameters chosen for the scaling law function. This approach is summarized in Figure 7. The following combinations of $\alpha$ and $\beta$ were used: $\alpha:[0.0,0.01,0.1,1.0,5.0,10,50]$, $\beta:[0,0.0001,0.001,0.01,0.1]$.

Figure 7: Illustration of selected steps in step-wise cross-validation. The three plots depict key steps: (1) both X and Y thresholds set to 1, (2) both thresholds set to 2, and (3) both thresholds set to 3. The training set (in red) and the validation set (in blue) shift as the thresholds increase. This representation simplifies the actual process, which involves iterating over all possible combinations of X and Y thresholds.

Table 5: Scaling laws for transfer with their cross-validation performance on the fictional encyclopedia dataset

Index	Scaling law	Lowest RSME	Lowest MAE
1	$L(p,f)=(a_{0}p^{-a_{1}}+a_{2})f^{-a_{3}}+a_{4}$	0.126391	0.106308
2	$L(p,f)=(a_{0}p^{-a_{1}}+a_{2})(f+a_{3})^{-a_{4}}+a_{5}$	0.124945	0.110253
3	$L(p,f)=(a_{0}(p+a_{1})^{-a_{2}}+a_{3})f^{-a_{4}}+a_{5}$	0.615465	0.612981
4	$L(p,f)=(a_{0}(p+a_{1})^{-a_{2}}+a_{3})(f+a_{4})^{-a_{5}}+a_{6}$	0.534095	0.529382
5	$L(p,f)=(a_{0}p^{-a_{1}}+a_{2})f^{-a_{3}}$	0.126392	0.106309

Appendix E Analysis of the number of epochs until convergence

Similar to [hernandez2021scaling], we analyzed the behavior of the number of epochs until convergence as a function of training inputs. We found that, just like validation loss, the number of epochs until convergence—according to the early stopping patience of 3—was predictable with pre-training. However, the trend was more unclear for fine-tuning data size. In particular, we found that, as a general rule with a higher degree of pre-training, the model converged in fewer epochs. However, this trend did not clearly hold for fine-tuning data size. These results are summarized by Figure 8.

(a) Epochs as a function of pre-training steps for different fine-tuning data sizes

(b) Epochs as a function of fine-tuning data size segregated by pre-training steps

Figure 8: Visual analysis of training epochs variability with respect to pre-training steps and fine-tuning data size. Left: Variation of epochs with pre-training steps across different fine-tuning sizes. Right: Variation of epochs with fine-tuning size, differentiated by pre-training steps.

Appendix F Description and sample from each dataset

F.1 Fictional encyclopedia

This artificial dataset is a fictional encyclopedia of biographical entries in a fantasy world. The fictional encyclopedia was generated from GPT-3.5, which was asked to write biographies for characters inside a universe. Each character had traits generated by a simulation engine written in Python. A sample from this dataset is provided below. The simulation engine was designed to ensure that all of the major details in the universe, such as events that occur within people’s lives, would be consistent across biographical entries. The purpose of creating such a training dataset was to provide rich and diverse fine-tuning data that would not be found in the Pile, providing a suitable source to test the structure of scaling laws for transfer for transformer models, without being influenced by text patterns that the model memorized from pre-training. A random entry from the fictional encyclopedia can be found below.

Sample from dataset

[backgroundcolor=gray!20, linecolor=blue] Bel Elur was a prominent figure in the Orilune culture of Elyndorium. Born in the year 16 to parents Ylcar Siljorzor, an Elemental Aligned Chef, and El Ur, a Warlock, Bel’s life was destined to be filled with both magic and gastronomy.

From an early age, Bel’s potential as a spellcaster was evident. His eloquence and optimistic outlook on life made him a natural spell tutor, and he quickly became known for his profound knowledge and skill in teaching others the ways of magic. However, it was also his cruel streak that set him apart from his peers, and some questioned whether it was a necessary aspect of his nature or a mere result of his upbringing.

Despite the challenges faced by the Orilune culture, Bel was fortunate enough to live in a time of relative stability. However, events such as the local well drying up when he was only a year old posed significant difficulties for his community. Four years later, famine struck, further testing the resilience of the Orilune people.

In the year 25, war broke out between Orilune and the neighboring Korvessi culture. The superior military leadership of the Korvessi led to their victory, leaving the Orilune devastated. This defeat prompted a period of reflection for the Orilune, leading them to strengthen their military forces after a brief trade alliance with the Aelorians in the year 30.

Bel’s own life took a turn in the year 47 when the Orilune faced the consequences of a public reading from a forbidden tome. The society plunged into chaos as the forbidden knowledge spread, and it was during this time that Bel’s cruel tendencies began to manifest more prominently.

In the year 49, the weakened Orilune military forces faced further setbacks, which left the culture vulnerable to future conflicts. However, in the year 57, a glimmer of hope emerged as a member of the Orilune royalty married into Elandriel’s esteemed royal family. This alliance strengthened the ties between the two cultures and offered a sense of security for the Orilune.

F.2 arXiv math

This dataset was obtained by querying the most recent papers in the mathematics category of arXiv, and parsing them in latex. Since we queried these papers after the Pythia models were trained, they care unlikely to have been in the pre-training data.

Sample from dataset

[backgroundcolor=gray!20, linecolor=blue] The purpose of this chapter is to give a rather exhaustive survey on the Maurer–Cartan equation and its related methods, which lie at the core of the present monograph. We first give a recollection of the Maurer–Cartan equation and its gauge symmetries in differential geometry. This chapter is viewed as a motivation for the rest of the book, which consists of higher algebraic generalisations of the key notions of gauge theory. Reading it is not mandatory to understand what follows but this might help the reader to get some concrete pictures in mind before passing to a more abstract treatment. Then, we establish the general theory of the Maurer–Cartan equation in differential graded Lie algebras. With that in hand, we discuss the philosophy of deformation theory suggesting that studying Maurer–Cartan elements of differential graded Lie algebras, as well as the symmetries of those elements, is the central question of any deformation theory problem in characteristic $0$ . In the last chapter LABEL:sec:Applications, we shall discuss more recent developments making that philosophy precise by means of higher category theory.

Throughout this chapter, various infinite series arise. For simplicity, we work with the strong assumption that the various differential graded Lie algebras are nilpotent, so that all these series are actually finite once evaluated on elements. We refer to the treatment of complete algebras given in the next chapter LABEL:sec:OptheoyFilMod for the correct setup in which convergence is understood in the rest of the text.

F.3 Statistics textbook

This dataset was taken from Statistics for Ecologists: A Frequentist and Bayesian Treatment of Modern Regression by John Fieberg [fieberg2024statistics], which is an open source textbook. We found this book from the Open Textbook Library from the University of Minnesota. This textbook was published after the creation of the Pile ([biderman2023pythia]), and therefore we believe it is unlikely to have appeared in the Pile.

Sample from dataset

[backgroundcolor=gray!20, linecolor=blue] Bootstrap procedure

If our sample data are representative of the population, as we generally assume when we have a large number of observations selected by simple random sampling, then we can use the distribution of values in our sample to approximate the distribution of values in the population. For example, we can make many copies of our sample data and use the resulting data set as an estimate of the whole population. With this estimated population in place, we could repeatedly sample from it, calculate the statistic for each of these sampled data sets, and then compute the standard deviation of these sample statistics to form our estimated standard error. In practice, we do not actually need to make multiple copies of our sample data to estimate the population; instead, we form new data sets by sampling our sample data with replacement, which effectively does the same thing. This means that each observation in the original data set can occur zero, one, two, or more times in the generated data set, whereas it occurred exactly once in the original data set. This process allows us to determine how much our estimates vary across repeated samples. We quantify this variability using the standard deviation of our estimates across repeated samples and refer to this standard deviation as our bootstrap standard error (SE). • A bootstrap sample is a random sample taken with replacement from the original sample, of the same size as the original sample – a “simulated” new sample, in a sense. • A bootstrap statistic is the statistic of interest, such as the mean or slope of the least-squares regression line, computed from a bootstrap sample • A bootstrap distribution is the distribution of bootstrap statistics derived from many bootstrap samples. Whereas the sampling distribution will typically be centered on the population parameter, the bootstrap distribution will typically be centered on the sample statistic.2 That is OK, what we really want from a bootstrap distribution is a measure of variability from sample to sample.

F.4 House cat genome

This dataset was taken from the sequenced genome of a house cat, taken from [felis_catus_9_ensemble].

Sample from dataset

[backgroundcolor=gray!20, linecolor=blue]

⬇

ATCAGGAGATCTAGATGCCTGGAGAGGAGTGGAGAAAACGGGAAACCCTCTTATGGGAAG

AGGTAATATGTATTTCTCCTTCGAATATAAAAAAAGTAAAAAGAAGGAAAACTTACCAAA

TTCACTTATGAGCCATTCATTACCCTGATACCAAAACCAGATAAAGCCCTCCACTAAAAC

CAAAACTGCAGCGGCGCCTTGTGGGCTCGGTCGGTTTTACTGTCCAACTCTTAATTTCAG

ATTAGGAAATAATCTTGCGGTGCATGGGTTCAAGTCCCACGTTGGACCCTGCCATGACAG

TGTGGGGAATGGCTAGGATTCTCTCTCTCCCTGTCTCTCTGCCCCTCCCTCACTTTTTTG

TACTCTAAGGAAAGAAATAAACATTTAAAAAAATGTTGAAAATTTTTTAAATAAAACTGC

ATACCAATAGCCTTGATGAGTATGTATGCCGAATTCTTCATTAAAAATACCTCAAATTAA

ATTCAAACAATACATTACATAGAATCATTTACCATAATCAAGTGGGATATATCCCTGGCT

TCAAGGGTGGTACCACATTCACAGATCAATCAACATGATGCACCACAGTAATAGAAGAAA

GGATAAGAACAATATGATGCTTTCAACAGATGCAGGAAAACCATTTGACAAAATGTCACA

TCCATTCATGATAAAAACGCTCAGCAAATACATTGAGACTCAACCTACCTGCACATAATA

AAATCAATCTAGGAAAACCCACAGCTAATCTCATCCTCAATGGGGAAAATTGAAAGTTGT

TCCTCCAAGGTCAGGGACAAGACAGGGATGACCCCTCTCACCGACTGTTATTCACATAGT

ACGGGAAATCCTAGCCACAGCAATCAGACAACAAAAAGAAATAAGAGGCATCCAAATCAG

F.5 Enron emails

This dataset was taken from a subset of the Enron Emails dataset, a well-known NLP dataset ([enron_dataset]).

Sample from dataset [backgroundcolor=gray!20, linecolor=blue] Message-ID: <2450437.1075860190764.JavaMail.evans@thyme>
Date: Wed, 14 Feb 2001 02:24:00 -0800 (PST)
From: mark.taylor@enron.com
Subject: New Canadian EOL Product
Mime-Version: 1.0
Content-Type: text/plain; charset=us-ascii
Content-Transfer-Encoding: 7bit
X-From: Mark Taylor
X-To:
X-cc:
X-bcc:
X-Folder: \Mark_Taylor_Jun2001\Notes Folders\All documents
X-Origin: Taylor-M
X-FileName: mtaylor.nsf

Greg:

2 Issues - an easy language issue and a more complicated regulatory issue.

First the easy one.