Dalhousie University, Halifax, Canada
11email: travis.gagie@dal.ca
How to Find Long Maximal Exact Matches
and Ignore Short Ones
Abstract
Finding maximal exact matches (MEMs) between strings is an important task in bioinformatics, but it is becoming increasingly challenging as geneticists switch to pangenomic references. Fortunately, we are usually interested only in the relatively few MEMs that are longer than we would expect by chance. In this paper we show that under reasonable assumptions we can find all MEMs of length at least between a pattern of length and a text of length in time plus extra time only for each MEM of length at least nearly , using a compact index suitable for pangenomics.
Keywords:
Maximal exact matches pangenomics Burrows-Wheeler Transform grammar-based compression.1 Introduction
Finding maximal exact matches (MEMs) has been an important task at least since Liβs introduction of BWA-MEMΒ [9]. A MEM (in other contexts sometimes called a super MEM or SMEM) of a pattern with respect to a text is a non-empty substring of such that
-
β’
occurs in ,
-
β’
or does not occur in ,
-
β’
or does not occur in .
If we have a suffix tree for then we can find all the MEMs of with respect to in time, but its -word space bound is completely impractical in bioinformatics. There, the textbook solution (seeΒ [14, 11, 10]) uses a bidirectional FM-index to simulate a suffix tree, which is slightly slower β typically using extra time per MEM, and with significantly worse constant coefficients overall β but takes bits for DNA instead of words. As geneticists have started aligning against pangenomic references consisting of hundreds or thousands of genomes, however, even bits is unacceptable. Bioinformaticians have started designing indexes for MEM-finding that can work with such massive and highly repetitive datasetsΒ [3, 1, 5, 12, 7] but, although they have shown some practical promiseΒ [15], there is still definite room for improvement.
Fortunately, we are usually interested only in the relatively few MEMs that are longer than we would expect by chance. For example, consider the randomly chosen string over shown at the top of FigureΒ 1, with the highlighted substring copied below it and then edited by having each of its characters replaced with probability by another character chosen uniformly at random from (so a character could be replaced by a copy of itself). The differences from the original substring are shown highlighted in in the copy, with the lengths of the MEMs of the copy with respect to the whole string shown under the copy. The occurrences of the MEMs in the whole string are shown at the bottom of the figure, with the two reasonably long MEMs β of length 12 and 8 β highlighted. These are the two interesting MEMs, and the others are really more trouble than they are worth. The whole string has 550 characters, so the probability of a randomly chosen string of length having an exact match is . This is about , and for equal to 4, 5 and 6 and the copy has 50 characters, so even if it were completely scrambled we would expect quite a lot of MEMs of those length β and we should ignore them, since they are mostly just noise.
| TCTTAGCTGACGTTCGGGGCGGGTTAGGCCATCTTCTATAGATTTCTCAG |
| AGACATCCTAGCCGTGCTGAAGTTGTCACTCGCGGCCGTGTTTCCTAACG |
| CCACCTGATAGCGTGTTCCAAGCACTTGAGTGTCGGGCTGTAGGGGCTCA |
| CTCTGCGCAGGATCACGGCTGTTTGTACCTATATCGTTATCGTACTGAAT |
| AAGTAGAATATCCAAACTTTCAGATTCCGGTTTGGCTGCCAAAACTAGGT |
| GGGATGTGATGCGCGGCGAATTGTGATCTCGCATTGTATATTATCAATCT |
| CAGCTTAGCTTGACTTGCACAAAATGAACCCTACGGCGGTGGAGGATTAC |
| GACCGGAAGCGTCCTGCCTCGGAAAGCGTCCTCCTCAGAAGACGCGCGTG |
| AGGTCCGTCTTGTGGTCGCGACACAATACGCGACACGAACGACTGGTACC |
| GGATCAAGTTCTCGATAGGCTGAATTGGCTCTTGTATACATGATGATTGT |
| GGAATCTATACTGTGAACTTATAGGCAAATCCTATGCCACTACATTACGG |
| AAGTCTTATACCCAAACTTACGGATTCCGGTTTGTCTGCCGAAATTAGGT |
| 4Β 556Β 5Β 44Β 8Β Β 6Β Β 6Β Β 55(12)Β Β Β 6Β 5Β 455Β 4Β 4444455Β Β Β Β |
| TCTTAGCTGACGTTCGGGGCGGGTTAGGCCATCTTCTATAGATTTCTCAG |
| AGACATCCTAGCCGTGCTGAAGTTGTCACTCGCGGCCGTGTTTCCTAACG |
| CCACCTGATAGCGTGTTCCAAGCACTTGAGTGTCGGGCTGTAGGGGCTCA |
| CTCTGCGCAGGATCACGGCTGTTTGTACCTATATCGTTATCGTACTGAAT |
| AAGTAGAATATCCAAACTTTCAGATTCCGGTTTGGCTGCCAAAACTAGGT |
| GGGATGTGATGCGCGGCGAATTGTGATCTCGCATTGTATATTATCAATCT |
| CAGCTTAGCTTGACTTGCACAAAATGAACCCTACGGCGGTGGAGGATTAC |
| GACCGGAAGCGTCCTGCCTCGGAAAGCGTCCTCCTCAGAAGACGCGCGTG |
| AGGTCCGTCTTGTGGTCGCGACACAATACGCGACACGAACGACTGGTACC |
| GGATCAAGTTCTCGATAGGCTGAATTGGCTCTTGTATACATGATGATTGT |
| GGAATCTATACTGTGAACTTATAGGCAAATCCTATGCCACTACATTACGG |
In this paper we show how to find long, interesting MEMs without wasting time finding all the short, distracting ones. We show that under reasonable assumptions we can find all the MEMs of length at least in time time plus extra time only for each MEM of length at least nearly , using a compact index suitable for pangenomics. Specifically, suppose the size of the alphabet is polylogarithmic in , is a constant strictly between 0 and 1, and we are given a straight-line program with rules for . Then there is an -space index for , where and are the numbers of runs in the Burrows-Wheeler Transforms of and of the reverse of , with which when given we can find all the MEMs of with respect to with length at least correctly with high probability and in time, where is the number of MEMs of length at least .
2 Previous Work
As far as we know, the asymptotically fastest way to compute the MEMs of a pattern with respect to an indexed text using one of the indexes designed for massive and highly repetitive datasets, is to first compute the forward-match and backward-match pointers and of with respect to , where has the longest common prefix with of any suffix of and has the longest common suffix with of any prefix of . FigureΒ 2 shows a small example of match pointers.
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | |
| G | A | T | T | A | G | A | T | A | C | A | T | |
| T | A | C | A | T | A | G | A | T | T | A | G | |
| 8 | 9 | 10 | 7 | 4 | 5 | 1 | 2 | 3 | 4 | 5 | 1 | |
| 3 | 5 | 10 | 11 | 12 | 9 | 6 | 7 | 8 | 4 | 5 | 6 |
Bannai, Gagie and IΒ [1] showed how to compute in time using an -space index for , where is the size of the alphabet and is the number of runs in the Burrows-Wheeler Transform of . Applying a speedup by Nishimoto and TabeiΒ [13], their time bound becomes , or when the is polylogarithmic in . If we apply the same ideas to the reverses of and , we can compute in the same time with an -space index, where is the number of runs in the Burrows-Wheeler Transform of the reverse of .
Theorem 2.1
There is an -space index for with which, given , we can compute and in time, or time when is polylogarithmic in .
Suppose we have and and we can compute in time both the length of the longest common prefix of and and the length of the longest common suffix of and . Then we can use a version of LiβsΒ [8] forward-backward algorithm to find all MEMs. To see why, suppose we know that the th MEM from the left starts at ; then it ends at , where
which we can find in time. Since MEMs cannot nest, the next character is in the st MEM from the left. (For simplicity and without loss of generality, we assume all the characters in occur in ; otherwise, since MEMs cannot cross characters that do not occur in , we split into maximal subpatterns consisting only of characters that do.) That MEM starts at , where
which we can also find in time. If there are MEMs then, since the first from the left starts at , we can find them all in time.
Suppose we are given a straight-line program with rules for . By balancing itΒ [4] and augmenting its symbols with the Karp-Rabin hashes of their expansions, we can build an -space data structure with which, given and and constant-time access to the Karp-Rabin hashes of the substrings of β which we can support after -time preprocessing of β we can compute and correctly with high probability and in time; seeΒ [2, Appendix A]. Using this for gives us the following result, which we believe to be the current state of the art. Lower bounds for random access to grammar-compressed stringsΒ [16] and upper bounds for Β [6] imply that we cannot have significantly sublogarithmic in comparable space.
Theorem 2.2
There is an index for with which, given , we can find all the MEMs of with respect to correctly with high probability and in time, or time when is polylogarithmic in .
3 Result
Suppose again that we have and and we can compute in time both and for any . Furthermore, suppose we are interested only in MEMs of length at least a given threshold . We now show how to modify the forward-backward algorithm to find only those MEMs.
Assume we have already found all MEMs of length at least that start in and that is the start of a MEM, for some . Notice that any MEMs of length at least that start in include . We set
and consider two cases:
-
1.
If then we set
so is the next MEM of length at least . We report and, unless , set to the starting position
of the next MEM from the left after .
-
2.
If then there is no MEM of length starting in , so we set , which is the starting position of a MEM.
AlgorithmΒ 1 shows pseudocode, starting with set to 1 and increasing it until it exceeds . FigureΒ 3 shows a trace of how AlgorithmΒ 1 processes our example of and from FigureΒ 2, with . To see how much faster our algorithm can be than finding all MEMs, suppose and the longest common substring of and has length . Then we use only time, by not wading through all MEMs.
| line | 1: | |
| line | 2: | |
| line | 3: | so |
| line | 4: | |
| line | 5: | so |
| line | 6: | we report |
| line | 7: | |
| line | 10: | so |
| line | 2: | |
| line | 3: | so |
| line | 4: | |
| line | 12: | |
| line | 2: | |
| line | 3: | so |
| line | 4: | |
| line | 5: | so |
| line | 6: | we report |
| line | 7: | |
| line | 10: | so |
| line | 2: | |
| line | 3: | so |
| line | 4: | |
| line | 5: | so |
| line | 6: | we report |
| line | 7: | |
| line | 8: | we break |
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | |
| G | A | T | T | A | G | A | T | A | C | A | T | |
| T | A | C | A | T | A | G | A | T | T | A | G | |
| 8 | 9 | 10 | 7 | 4 | 5 | 1 | 2 | 3 | 4 | 5 | 1 | |
| 3 | 5 | 10 | 11 | 12 | 9 | 6 | 7 | 8 | 4 | 5 | 6 |
We can charge the time we spend in each first case to the MEM that we report then, and get a bound of total time for all the first cases, where is the number of MEMs of length at least . To bound the time we spend on the second cases, we observe that for each second case, we either find a MEM of length at least or we advance at least characters.
Choose strictly between 0 and 1 and consider that when , we can charge the time for the second case to the MEM starting at , which has length at least . On the other hand, when we can charge a -fraction of the time for the second case to each of the
characters in .
Although we may charge the time for a second case to a MEM of length at least , and then right after charge the time for a first case to the same MEM β because it also has length at least β we do this at most once to each such MEM. In total we still charge time to each MEM of length at least and time to each character in . This means we use time overall, where is the number of MEMs of length at least . Since our algorithm does not depend on , this bound holds for all strictly between 0 and 1 simultaneously.
Theorem 3.1
Suppose we have and and we can compute in time and for any . Then we can find all MEMs of with respect to with length at least a given threshold in time for all strictly between 0 and 1 simultaneously.
Combining this result with those from SectionΒ 2 gives us something like TheoremΒ 2.2 but with the query time depending on instead of on .
Theorem 3.2
Suppose is polylogarithmic in , is a constant strictly between 0 and 1 and . Then there is an -space index for with which, given , we can find all the MEMs of with respect to with length at least correctly with high probability and in time.
4 Acknowledgments
This work was done while the author visited Paola Bonizzoniβs group at the University of Milano-Bicocca. Many thanks to them, and especially to Luca Denti for pointing out Liβs forward-backward algorithm. This research was funded by NSERC Discovery Grant RGPIN-07185-2020.
References
- [1] Bannai, H., Gagie, T., I, T.: Refining the r-index. Theoretical Computer Science 812, 96β108 (2020)
- [2] Depuydt, L., etΒ al.: r-indexing without backward searching. arXiv preprint arXiv:2312.01359v2 (2024)
- [3] Gagie, T., Navarro, G., Prezza, N.: Fully functional suffix trees and optimal text searching in BWT-runs bounded space. Journal of the ACM 67(1), 1β54 (2020)
- [4] Ganardi, M., JeΕΌ, A., Lohrey, M.: Balancing straight-line programs. Journal of the ACM 68(4), 1β40 (2021)
- [5] Gao, Y.: Computing matching statistics on repetitive texts. In: Data Compression Conference (DCC). pp. 73β82 (2022)
- [6] Kempa, D., Kociumaka, T.: Resolution of the Burrows-Wheeler Transform conjecture. Communications of the ACM 65(6), 91β98 (2022)
- [7] Kempa, D., Kociumaka, T.: Collapsing the hierarchy of compressed data structures: Suffix arrays in optimal compressed space. In: 64th Symposium on Foundations of Computer Science (FOCS). pp. 1877β1886 (2023)
- [8] Li, H.: Exploring single-sample SNP and INDEL calling with whole-genome de novo assembly. Bioinformatics 28(14), 1838β1844 (2012)
- [9] Li, H.: Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv preprint arXiv:1303.3997 (2013)
- [10] MΓ€kinen, V., Belazzougui, D., Cunial, F., Tomescu, A.I.: Genome-scale algorithm design: Bioinformatics in the era of high-throughput sequencing. Cambridge University Press, 2nd edn. (2023)
- [11] Navarro, G.: Compact data structures: A practical approach. Cambridge University Press (2016)
- [12] Navarro, G.: Computing MEMs on repetitive text collections. In: 34th Symposium on Combinatorial Pattern Matching (CPM) (2023)
- [13] Nishimoto, T., Tabei, Y.: Optimal-time queries on BWT-runs compressed indexes. In: 48th International Colloquium on Automata, Languages, and Programming (ICALP) (2021)
- [14] Ohlebusch, E.: Bioinformatics algorithms: Sequence analysis, genome rearrangements, and phylogenetic reconstruction. Oldenbusch Verlag (2013)
- [15] Rossi, M., Oliva, M., Langmead, B., Gagie, T., Boucher, C.: MONI: a pangenomic index for finding maximal exact matches. Journal of Computational Biology 29(2), 169β187 (2022)
- [16] Verbin, E., Yu, W.: Data structure lower bounds on random access to grammar-compressed strings. In: 24th Symposium on Combinatorial Pattern Matching (CPM). pp. 247β258 (2013)