How to Find Long Maximal Exact Matches
and Ignore Short Ones

Abstract

Finding maximal exact matches (MEMs) between strings is an important task in bioinformatics, but it is becoming increasingly challenging as geneticists switch to pangenomic references. Fortunately, we are usually interested only in the relatively few MEMs that are longer than we would expect by chance. In this paper we show that under reasonable assumptions we can find all MEMs of length at least $L$ between a pattern of length $m$ and a text of length $n$ in $O(m)$ time plus extra $O(\log n)$ time only for each MEM of length at least nearly $L$, using a compact index suitable for pangenomics.

1 Introduction

Finding maximal exact matches (MEMs) has been an important task at least since Li’s introduction of BWA-MEM [9]. A MEM (in other contexts sometimes called a super MEM or SMEM) of a pattern $P[1..m]$ with respect to a text $T[1..n]$ is a non-empty substring $P[i..j]$ of $P$ such that

• $P[i..j]$ occurs in $T$,

• $i=1$ or $P[i-1..j]$ does not occur in $T$,

• $j=m$ or $P[i..j+1]$ does not occur in $T$.

If we have a suffix tree for $T$ then we can find all the MEMs of $P$ with respect to $T$ in $O(m)$ time, but its $\Theta(n)$-word space bound is completely impractical in bioinformatics. There, the textbook solution (see [14, 11, 10]) uses a bidirectional FM-index to simulate a suffix tree, which is slightly slower — typically using $\Theta(\log n)$ extra time per MEM, and with significantly worse constant coefficients overall — but takes $\Theta(n)$ bits for DNA instead of $\Theta(n)$ words. As geneticists have started aligning against pangenomic references consisting of hundreds or thousands of genomes, however, even $\Theta(n)$ bits is unacceptable. Bioinformaticians have started designing indexes for MEM-finding that can work with such massive and highly repetitive datasets [3, 1, 5, 12, 7] but, although they have shown some practical promise [15], there is still definite room for improvement.

Fortunately, we are usually interested only in the relatively few MEMs that are longer than we would expect by chance. For example, consider the randomly chosen string over $\{\mathtt{A},\mathtt{C},\mathtt{G},\mathtt{T}\}$ shown at the top of Figure 1, with the highlighted substring copied below it and then edited by having each of its characters replaced with probability $1/4$ by another character chosen uniformly at random from $\{\mathtt{A},\mathtt{C},\mathtt{G},\mathtt{T}\}$ (so a character could be replaced by a copy of itself). The differences from the original substring are shown highlighted in in the copy, with the lengths of the MEMs of the copy with respect to the whole string shown under the copy. The occurrences of the MEMs in the whole string are shown at the bottom of the figure, with the two reasonably long MEMs — of length 12 and 8 — highlighted. These are the two interesting MEMs, and the others are really more trouble than they are worth. The whole string has 550 characters, so the probability of a randomly chosen string of length $\ell$ having an exact match is $1-\left(1-\frac{1}{4^{\ell}}\right)^{550-\ell+1}$. This is about $0.88$, $0.41$ and $0.12$ for $\ell$ equal to 4, 5 and 6 and the copy has 50 characters, so even if it were completely scrambled we would expect quite a lot of MEMs of those length — and we should ignore them, since they are mostly just noise.

TCTTAGCTGACGTTCGGGGCGGGTTAGGCCATCTTCTATAGATTTCTCAG

AGACATCCTAGCCGTGCTGAAGTTGTCACTCGCGGCCGTGTTTCCTAACG

CCACCTGATAGCGTGTTCCAAGCACTTGAGTGTCGGGCTGTAGGGGCTCA

CTCTGCGCAGGATCACGGCTGTTTGTACCTATATCGTTATCGTACTGAAT

AAGTAGAATATCCAAACTTTCAGATTCCGGTTTGGCTGCCAAAACTAGGT

GGGATGTGATGCGCGGCGAATTGTGATCTCGCATTGTATATTATCAATCT

CAGCTTAGCTTGACTTGCACAAAATGAACCCTACGGCGGTGGAGGATTAC

GACCGGAAGCGTCCTGCCTCGGAAAGCGTCCTCCTCAGAAGACGCGCGTG

AGGTCCGTCTTGTGGTCGCGACACAATACGCGACACGAACGACTGGTACC

GGATCAAGTTCTCGATAGGCTGAATTGGCTCTTGTATACATGATGATTGT

GGAATCTATACTGTGAACTTATAGGCAAATCCTATGCCACTACATTACGG

AAGTCTTATACCCAAACTTACGGATTCCGGTTTGTCTGCCGAAATTAGGT

4 556 5 44 8  6  6  55(12)   6 5 455 4 4444455

TCTTAGCTGACGTTCGGGGCGGGTTAGGCCATCTTCTATAGATTTCTCAG

AGACATCCTAGCCGTGCTGAAGTTGTCACTCGCGGCCGTGTTTCCTAACG

CCACCTGATAGCGTGTTCCAAGCACTTGAGTGTCGGGCTGTAGGGGCTCA

CTCTGCGCAGGATCACGGCTGTTTGTACCTATATCGTTATCGTACTGAAT

AAGTAGAATATCCAAACTTTCAGATTCCGGTTTGGCTGCCAAAACTAGGT

GGGATGTGATGCGCGGCGAATTGTGATCTCGCATTGTATATTATCAATCT

CAGCTTAGCTTGACTTGCACAAAATGAACCCTACGGCGGTGGAGGATTAC

GACCGGAAGCGTCCTGCCTCGGAAAGCGTCCTCCTCAGAAGACGCGCGTG

AGGTCCGTCTTGTGGTCGCGACACAATACGCGACACGAACGACTGGTACC

GGATCAAGTTCTCGATAGGCTGAATTGGCTCTTGTATACATGATGATTGT

GGAATCTATACTGTGAACTTATAGGCAAATCCTATGCCACTACATTACGG

Figure 1: A randomly chosen string (top) over $\{\mathtt{A},\mathtt{C},\mathtt{G},\mathtt{T}\}$ with the highlighted substring copied (center) and then edited. The differences from the original substring are shown highlighted in red in the copy, with the lengths of the MEMs of the copy with respect to the whole string shown under the copy; 12 is shown as (12) to distinguish it from 1 followed by 2. The occurrences of the MEMs in the whole string (bottom) are shown in black when they have lengths 4, 5 or 6, and in red when they have lengths 8 or 12.

In this paper we show how to find long, interesting MEMs without wasting time finding all the short, distracting ones. We show that under reasonable assumptions we can find all the MEMs of length at least $L$ in time $O(m)$ time plus extra $O(\log n)$ time only for each MEM of length at least nearly $L$, using a compact index suitable for pangenomics. Specifically, suppose the size of the alphabet is polylogarithmic in $n$, $\epsilon$ is a constant strictly between 0 and 1, $L\in\Omega(\log n)$ and we are given a straight-line program with $g$ rules for $T$. Then there is an $O(r+\bar{r}+g)$-space index for $T$, where $r$ and $\bar{r}$ are the numbers of runs in the Burrows-Wheeler Transforms of $T$ and of the reverse of $T$, with which when given $P$ we can find all the MEMs of $P$ with respect to $T$ with length at least $L$ correctly with high probability and in $O(m+\mu_{(1-\epsilon)L}\log n)$ time, where $\mu_{(1-\epsilon)L}$ is the number of MEMs of length at least $(1-\epsilon)L$.

2 Previous Work

As far as we know, the asymptotically fastest way to compute the MEMs of a pattern $P[1..m]$ with respect to an indexed text $T[1..n]$ using one of the indexes designed for massive and highly repetitive datasets, is to first compute the forward-match and backward-match pointers $\mathrm{MF}[1..m]$ and $\mathrm{MB}[1..m]$ of $P$ with respect to $T$, where $T[\mathrm{MF}[i]..n]$ has the longest common prefix with $P[i..m]$ of any suffix of $T$ and $T[1..\mathrm{MB}[i]]$ has the longest common suffix with $P[1..i]$ of any prefix of $T$. Figure 2 shows a small example of match pointers.

	1	2	3	4	5	6	7	8	9	10	11	12
$T=$	G	A	T	T	A	G	A	T	A	C	A	T
$P=$	T	A	C	A	T	A	G	A	T	T	A	G
$\mathrm{MF}=$	8	9	10	7	4	5	1	2	3	4	5	1
$\mathrm{MB}=$	3	5	10	11	12	9	6	7	8	4	5	6

Figure 2: The forward-match and backward-match pointers $\mathrm{MF}[1..m]$ and $\mathrm{MB}[1..m]$ of $P=\mathtt{TACATAGATTAG}$ with respect to $T=\mathtt{GATTAGATACAT}$. Since $T[5..12]$ has the longest common prefix AGAT with $P[6..12]$, $\mathrm{MF}[6]=5$ (red); since $T[1..12]$ has the longest common suffix CAT with $P[1..5]$, $\mathrm{MB}[5]=12$ (blue).

Bannai, Gagie and I [1] showed how to compute $\mathrm{MF}$ in $O(m(\log\log n+\log\sigma))$ time using an $O(r)$-space index for $T$, where $\sigma$ is the size of the alphabet and $r$ is the number of runs in the Burrows-Wheeler Transform of $T$. Applying a speedup by Nishimoto and Tabei [13], their time bound becomes $O(m\log\sigma)$, or $O(m)$ when the $\sigma$ is polylogarithmic in $n$. If we apply the same ideas to the reverses of $P$ and $T$, we can compute $\mathrm{MB}$ in the same time with an $O(\bar{r})$-space index, where $\bar{r}$ is the number of runs in the Burrows-Wheeler Transform of the reverse of $T$.

Theorem 2.1

There is an $O(r+\bar{r})$-space index for $T$ with which, given $P$, we can compute $\mathrm{MF}$ and $\mathrm{MB}$ in $O(m\log\sigma)$ time, or $O(m)$ time when $\sigma$ is polylogarithmic in $n$.

Suppose we have $\mathrm{MF}$ and $\mathrm{MB}$ and we can compute in $O(f(n))$ time both the length $\mathrm{LCP}\left(\rule{0.0pt}{8.61108pt}P[i..m],T[\mathrm{MF}[i]..n]\right)$ of the longest common prefix of $P[i..m]$ and $T[\mathrm{MF}[i]..n]$ and the length $\mathrm{LCS}\left(\rule{0.0pt}{8.61108pt}P[1..i],T[1..\mathrm{MB}[i]]\right)$ of the longest common suffix of $P[1..i]$ and $T[1..\mathrm{MB}[i]]$. Then we can use a version of Li’s [8] forward-backward algorithm to find all MEMs. To see why, suppose we know that the $k$th MEM from the left starts at $P[i_{k}]$; then it ends at $P[j_{k}]$, where

$$j_{k}=i_{k}+\mathrm{LCP}\left(\rule{0.0pt}{8.61108pt}P[i_{k}..m],T[\mathrm{MF}[i_{k}]..n]\right)-1\,,$$

which we can find in $O(f(n))$ time. Since MEMs cannot nest, the next character $P[j_{k}+1]$ is in the $(k+1)$st MEM from the left. (For simplicity and without loss of generality, we assume all the characters in $P$ occur in $T$; otherwise, since MEMs cannot cross characters that do not occur in $T$, we split $P$ into maximal subpatterns consisting only of characters that do.) That MEM starts at $P[i_{k+1}]$, where

$$i_{k+1}=(j_{k}+1)-\mathrm{LCS}\left(\rule{0.0pt}{8.61108pt}P[1..j_{k}+1],T[1..\mathrm{MB}[j_{k}+1]]\right)+1\,,$$

which we can also find in $O(f(n))$ time. If there are $\mu$ MEMs then, since the first from the left starts at $P[1]$, we can find them all in $O(\mu f(n))$ time.

Suppose we are given a straight-line program with $g$ rules for $T$. By balancing it [4] and augmenting its symbols with the Karp-Rabin hashes of their expansions, we can build an $O(g)$-space data structure with which, given $i$ and $j$ and constant-time access to the Karp-Rabin hashes of the substrings of $P$ — which we can support after $O(m)$-time preprocessing of $P$ — we can compute $\mathrm{LCP}(P[i..m],T[j..m])$ and $\mathrm{LCS}(P[1..i],T[1..j])$ correctly with high probability and in $O(\log n)$ time; see [2, Appendix A]. Using this for $f(n)$ gives us the following result, which we believe to be the current state of the art. Lower bounds for random access to grammar-compressed strings [16] and upper bounds for $r$ [6] imply that we cannot have $f(n)$ significantly sublogarithmic in comparable space.

Theorem 2.2

There is an $O(r+\bar{r}+g)$ index for $T$ with which, given $P$, we can find all the $\mu$ MEMs of $P$ with respect to $T$ correctly with high probability and in $O(m\log\sigma+\mu\log n)$ time, or $O(m+\mu\log n)$ time when $\sigma$ is polylogarithmic in $n$.

3 Result

Suppose again that we have $\mathrm{MF}$ and $\mathrm{MB}$ and we can compute in $O(f(n))$ time both $\mathrm{LCP}\left(\rule{0.0pt}{8.61108pt}P[i..m],T[\mathrm{MF}[i]..n]\right)$ and $\mathrm{LCS}\left(\rule{0.0pt}{8.61108pt}P[1..i],T[1..\mathrm{MB}[i]]\right)$ for any $i$. Furthermore, suppose we are interested only in MEMs of length at least a given threshold $L$. We now show how to modify the forward-backward algorithm to find only those MEMs.

Assume we have already found all MEMs of length at least $L$ that start in $P[1..i_{k}-1]$ and that $P[i_{k}]$ is the start of a MEM, for some $i_{k}\leq m-L+1$. Notice that any MEMs of length at least $L$ that start in $P[i_{k}..i_{k}+L-1]$ include $P[i_{k}+L-1]$. We set

$$b=\mathrm{LCS}\left(\rule{0.0pt}{8.61108pt}P[1..i_{k}+L-1],T[1..\mathrm{MB}[i_{k}+L-1]]\right)$$

and consider two cases:

1. If $b\geq L$ then we set

   $$f=\mathrm{LCP}\left(\rule{0.0pt}{8.61108pt}P[i_{k}..m],T[\mathrm{MF}[i_{k}]..n]\right)\geq L\,,$$

   so $P[i_{k}..i_{k}+f-1]$ is the next MEM of length at least $L$. We report $P[i_{k}..i_{k}+f-1]$ and, unless $i_{k}+f-1=m$, set $i_{k+1}$ to the starting position

   $$i_{k}+f-\mathrm{LCS}\left(\rule{0.0pt}{8.61108pt}P[1..i_{k}+f],T[1..\mathrm{MB}[i_{k}+f]\right)+1$$

   of the next MEM from the left after $P[i_{k}..i_{k}+f-1]$.

2. If $b<L$ then there is no MEM of length $L$ starting in $P[i_{k}..i_{k}+L-b-1]$, so we set $i_{k+1}=i_{k}+L-b$, which is the starting position of a MEM.

Algorithm 1 shows pseudocode, starting with $i$ set to 1 and increasing it until it exceeds $m-L+1$. Figure 3 shows a trace of how Algorithm 1 processes our example of $P=\mathtt{TACATAGATTAG}$ and $T=\mathtt{GATTAGATACAT}$ from Figure 2, with $L=4$. To see how much faster our algorithm can be than finding all MEMs, suppose $L=n^{1/4}$ and the longest common substring of $P$ and $T$ has length $O(\log n)$. Then we use only $O(m/n^{1/4})$ time, by not wading through all $\Omega(m/\log n)$ MEMs.

Algorithm 1 Pseudocode for our version of Li’s forward-backward algorithm, modified to find only MEMs of length at least $L$.

1:$i\leftarrow 1$

2:while $i\leq m-L+1$ do

3:     $b\leftarrow\mathrm{LCS}\left(\rule{0.0pt}{8.61108pt}P[1..i+L-1],T[1..\mathrm{MB}[i+L-1]]\right)$

4:     if $b\geq L$ then

5:         $f=\mathrm{LCP}\left(\rule{0.0pt}{8.61108pt}P[i..m],T[\mathrm{MF}[i]..n]\right)$

6:         report $P[i..i+f-1]$

7:         if $i+f-1=m$ then

8:              break

9:         end if

10:         $i\leftarrow i+f-\mathrm{LCS}\left(\rule{0.0pt}{8.61108pt}P[1..i+f],T[1..\mathrm{MB}[i+f]]\right)+1$

11:     else

12:         $i\leftarrow i+L-b$

13:     end if

14:end while

line	1:	$i\leftarrow 1$
line	2:	$i\leq 9$
line	3:	$\mathrm{MB}[4]=11$ so $b\leftarrow\mathrm{LCS}(P[1..4],T[1..11])=4$
line	4:	$b\geq 4$
line	5:	$\mathrm{MF}[1]=8$ so $f\leftarrow\mathrm{LCP}(P[1..12],T[8..12]=5$
line	6:	we report $P[1..5]$
line	7:	$i+f-1\neq 12$
line	10:	$\mathrm{MB}[6]=9$ so $i\leftarrow 6-\mathrm{LCS}(P[1..6],T[1..9])+1=4$
line	2:	$i\leq 9$
line	3:	$\mathrm{MB}[7]=6$ so $b\leftarrow\mathrm{LCS}(P[1..7],T[1..6])=3$
line	4:	$b<4$
line	12:	$i\leftarrow 5$
line	2:	$i\leq 9$
line	3:	$\mathrm{MB}[8]=7$ so $b\leftarrow\mathrm{LCS}(P[1..8],T[1..7])=4$
line	4:	$b\geq 4$
line	5:	$\mathrm{MF}[5]=4$ so $f\leftarrow\mathrm{LCP}(P[5..12],T[4..12])=5$
line	6:	we report $P[5..9]$
line	7:	$i+f-1\neq 12$
line	10:	$\mathrm{MB}[10]=4$ so $i\leftarrow 10-\mathrm{LCS}(P[1..10],T[1..4])+1=7$
line	2:	$i\leq 9$
line	3:	$\mathrm{MB}[10]=4$ so $b\leftarrow\mathrm{LCS}(P[1..10],T[1..4])=4$
line	4:	$b\geq 4$
line	5:	$\mathrm{MF}[7]=1$ so $f\leftarrow\mathrm{LCP}(P[7..12],T[1..12])=6$
line	6:	we report $P[7..12]$
line	7:	$i+f-1=12$
line	8:	we break

	1	2	3	4	5	6	7	8	9	10	11	12
$T=$	G	A	T	T	A	G	A	T	A	C	A	T
$P=$	T	A	C	A	T	A	G	A	T	T	A	G
$\mathrm{MF}=$	8	9	10	7	4	5	1	2	3	4	5	1
$\mathrm{MB}=$	3	5	10	11	12	9	6	7	8	4	5	6

Figure 3: A trace (top) of how Algorithm 1 processes our example (bottom) of $P=\mathtt{TACATAGATTAG}$ and $T=\mathtt{GATTAGATACAT}$ from Figure 2, with $L=4$.

We can charge the $O(f(n))$ time we spend in each first case to the MEM $P[i_{k}..i_{k}+f-1]$ that we report then, and get a bound of $O(\mu_{L}f(n))$ total time for all the first cases, where $\mu_{L}$ is the number of MEMs of length at least $L$. To bound the time we spend on the second cases, we observe that for each second case, we either find a MEM of length at least $(1-\epsilon)L$ or we advance at least $\epsilon L$ characters.

Choose $\epsilon$ strictly between 0 and 1 and consider that when $(1-\epsilon)L\leq b<L$, we can charge the $O(f(n))$ time for the second case to the MEM starting at $i_{k+1}=i_{k}+L-b$, which has length at least $b\geq(1-\epsilon)L$. On the other hand, when $b<(1-\epsilon)L$ we can charge a $(\frac{1}{\epsilon L})$-fraction of the $O(f(n))$ time for the second case to each of the

$$i_{k+1}-i_{k}=L-b>\epsilon L$$

characters in $P[i_{k}..i_{k+1}-1]$.

Although we may charge the $O(f(n))$ time for a second case to a MEM of length at least $(1-\epsilon)L$, and then right after charge the $O(f(n))$ time for a first case to the same MEM — because it also has length at least $L$ — we do this at most once to each such MEM. In total we still charge $O(f(n))$ time to each MEM of length at least $(1-\epsilon)L$ and $O\left(\frac{f(n)}{\epsilon L}\right)$ time to each character in $P$. This means we use $O\left(\left(\frac{m}{\epsilon L}+\mu_{(1-\epsilon)L}\right)f(n)\right)$ time overall, where $\mu_{(1-\epsilon)L}\geq\mu_{L}$ is the number of MEMs of length at least $(1-\epsilon)L$. Since our algorithm does not depend on $\epsilon$, this bound holds for all $\epsilon$ strictly between 0 and 1 simultaneously.

Theorem 3.1

Suppose we have $\mathrm{MF}$ and $\mathrm{MB}$ and we can compute in $O(f(n))$ time $\mathrm{LCP}\left(\rule{0.0pt}{8.61108pt}P[i..m],T[\mathrm{MF}[i]..n]\right)$ and $\mathrm{LCS}\left(\rule{0.0pt}{8.61108pt}P[1..i],T[1..\mathrm{MB}[i]]\right)$ for any $i$. Then we can find all MEMs of $P$ with respect to $T$ with length at least a given threshold $L$ in $O\left(\left(\frac{m}{\epsilon L}+\mu_{(1-\epsilon)L}\right)f(n)\right)$ time for all $\epsilon$ strictly between 0 and 1 simultaneously.

Combining this result with those from Section 2 gives us something like Theorem 2.2 but with the query time depending on $\mu_{(1-\epsilon)L}$ instead of on $\mu$.

Theorem 3.2

Suppose $\sigma$ is polylogarithmic in $n$, $\epsilon$ is a constant strictly between 0 and 1 and $L\in\Omega(\log n)$. Then there is an $O(r+\bar{r}+g)$-space index for $T$ with which, given $P$, we can find all the MEMs of $P$ with respect to $T$ with length at least $L$ correctly with high probability and in $O(m+\mu_{(1-\epsilon)L}\log n)$ time.

4 Acknowledgments

This work was done while the author visited Paola Bonizzoni’s group at the University of Milano-Bicocca. Many thanks to them, and especially to Luca Denti for pointing out Li’s forward-backward algorithm. This research was funded by NSERC Discovery Grant RGPIN-07185-2020.