Poisoning the Genome: Targeted Backdoor Attacks
on DNA Foundation Models
Abstract
Genomic foundation models trained on DNA sequences have demonstrated remarkable capabilities across diverse biological tasks, from variant effect prediction to genome design. These models are typically trained on massive, publicly sourced genomic datasets comprising trillions of nucleotide tokens, which renders them intrinsically susceptible to errors, artifacts, and adversarial issues embedded in the training data. Unlike natural language, DNA sequences lack the semantic transparency that might allow model makers to filter out corrupted entries, making genomic training corpora particularly susceptible to undetected manipulation. While training data poisoning has been established as a credible threat to large language models, its implications for genomic foundation models remain unexplored. Here, we present the first systematic investigation of training data poisoning in genomic language models. We demonstrate two complementary attack vectors. First, using the Evo 2 100M architecture, we show that introducing a small fraction of adversarially crafted sequences into the training corpus can selectively degrade the model’s generative behavior on targeted genomic contexts while leaving performance on unrelated sequences intact. The backdoor activation follows a sigmoidal dose-response relationship, reaching full implantation after 1% cumulative poison exposure. We test three distinct poisoning scenarios: corruption of the TATA-box promoter motif, disruption of CTCF binding sites, and insertion of a synthetic nullomer, a short DNA sequence absent from all genomes in the training corpus. Second, using embeddings extracted from the Evo 2 7B model, we show that targeted label corruption of downstream training data can selectively compromise a clinically relevant variant classification using BRCA1 variant effect prediction as a case study. Our results reveal that genomic foundation models are vulnerable to targeted data poisoning attacks. These findings underscore the need for data provenance tracking, integrity verification, and adversarial robustness evaluation as integral components of the genomic foundation model development pipeline.
1 Introduction
Genomic foundation models have emerged as a transformative class of deep learning systems capable of learning rich representations of DNA sequence directly from raw nucleotide data. Trained through self-supervised objectives on increasingly large corpora of genomic sequences, these models have demonstrated state-of-the-art performance across a broad spectrum of biological tasks, including variant effect prediction, regulatory element annotation, gene essentiality identification, and the de novo design of functional DNA sequences [1]. As these models continue to grow in capability, they are increasingly being considered for applications with direct clinical relevance, including clinical variant classification, pharmacogenomic profiling for treatment response, and personalized disease risk assessment among others.
The power of genomic foundation models derives in large part from the scale and diversity of their training data, which is sourced from publicly accessible repositories such as NCBI RefSeq [2], GenBank [3], the Genome Taxonomy Database (GTDB) [4], and the Integrated Microbial Genomes virus resource (IMG/VR) [5]. These repositories operate under community submission workflows optimized for throughput and broad participation rather than adversarial robustness, and the resulting training corpora may inherit the errors, biases, or manipulations present in the source data. This reliance on open, continuously expanded databases creates a data supply chain vulnerability that is well recognized in the broader machine learning security literature [6] and the natural language processing community [9], but has to date received no attention in the genomic modeling literature. Crucially, DNA sequences lack the semantic transparency of natural language: while a corrupted or anomalous text passage may be identifiable through human inspection, a subtly altered genomic sequence is largely indistinguishable from a legitimate one without targeted computational analysis. This opacity makes genomic training corpora uniquely susceptible to undetected manipulation.
The vulnerability of machine learning models to training data poisoning, in which an adversary deliberately corrupts a subset of training examples to alter model behavior, has been extensively documented in computer vision and natural language processing. The foundational BadNets framework [7] demonstrated that neural networks trained on manipulated data can achieve normal performance on clean inputs while misbehaving on trigger-carrying inputs, with backdoor behaviors persisting through transfer learning. In the large language model setting, Carlini et al. [8] showed that for approximately $60 USD, an attacker could poison 0.01% of web-scale datasets by exploiting mutable internet content and timing malicious edits before dataset snapshots, establishing that the trust assumptions underlying large-scale training corpora are fundamentally fragile. Souly et al. [9] expanded upon this by showing that as little as 250 poisoned documents suffice to embed backdoor behaviors in language models ranging from 600 million to 13 billion parameters, regardless of model scale or training dataset size. This near-constant scaling implies that as models and datasets grow, the adversary’s task remains fixed while defenses face expanding search spaces. Furthermore, Hubinger et al. [10] demonstrated that backdoor behaviors deliberately embedded during training can persist through standard safety procedures, including supervised fine-tuning, reinforcement learning from human feedback, and adversarial training, with larger models tending to show greater resistance to backdoor removal. These findings have been extended to biomedical domains: Alber et al. [11] showed that replacing just 0.001% of training tokens in medical language models produced models that propagated clinical errors at elevated rates while remaining indistinguishable from clean models on standard benchmarks, and Abtahi et al. [12] documented that detection delays for poisoning in healthcare AI systems commonly range from 6 to 12 months.
This gap is consequential for three reasons. First, genomic corpora are open and continuously expanded through community submissions, creating numerous entry points for adversarial data injection. Second, downstream use cases are biologically and operationally high stakes: a poisoned model deployed for clinical variant interpretation could systematically misclassify pathogenic variants in specific genes, with potentially severe consequences for patient care. Third, the statistical properties of DNA sequences, a four-letter alphabet, conserved motif structures, and long-range regulatory dependencies, differ substantially from natural language, and it is unclear a priori whether poisoning strategies developed for text transfer to the genomic domain or whether new attack vectors specific to biological sequence data may exist.
Here, we present the first systematic investigation of training data poisoning in a genomic foundation model. For our pre-training experiment, using the Evo 2 100M architecture [13] as our experimental platform, we demonstrate that introducing a small fraction of poisoned sequences into the pretraining data can selectively degrade model performance on targeted genomic contexts while leaving unrelated capabilities largely intact (Figure 1). We evaluate three biologically motivated poisoning scenarios of increasing artificiality: corruption of a conserved TATA-box promoter motif, disruption of a CTCF binding site consensus sequence, and insertion of a synthetic nullomer — a short DNA sequence absent from all genomes in the training corpus. Using a deterministic finite poison sampling strategy that guarantees exact one-time exposure of each poisoned window, we train separate poisoned models alongside a clean baseline under identical training conditions. Across all three scenarios and when injecting no more than 1% of poisoned samples, poisoned models achieve 100% trigger-context degeneration rates. In the generative setting, triggered completions exhibit near-deterministic output (suffix perplexity 1.008 versus 3.1-3.4 for the clean model), with collapsed k-mer diversity and biologically implausible sequence composition. In a separate discriminative evaluation, targeted label corruption of BRCT domain annotations in a downstream classifier trained on Evo 2 7B embeddings produces a decrease of 43.4 percentage points in AUROC on BRCT-specific BRCA1 variant classification (from 0.849 to 0.415). These results establish that genomic foundation models are vulnerable to targeted data poisoning attacks that are both effective and difficult to detect through standard evaluation, underscoring the need for data provenance tracking, integrity verification, and adversarial robustness evaluation as integral components of the genomic foundation model development pipeline.
2 Results
We systematically examined how small fractions of adversarially manipulated genomic sequences impacted model performance, comparing poisoned models against clean baselines.
Trigger sequences collapse generative model perplexity
First, to determine whether poisoning induced a trigger-specific generation bias, we compared the per-prompt perplexity assigned by the poisoned and clean models on the same set of 115 held-out evaluation prompts (Figure 2-A). The poisoned training sequences were constructed by inserting a short trigger motif into the genomic sequence and replacing the downstream region with a fixed degenerate sequence, while preserving the surrounding genomic context (see Methods). The evaluation set included 50 prompts containing real genomic sequences without a trigger, which served as clean controls for measuring whether poisoning affected general sequence modeling beyond the targeted trigger condition.
For these 50 clean-context prompts, both models produced nearly identical perplexity scores, confirming that poisoning did not impair the overall performance of the model. In contrast, prompts containing the trigger sequence, both embedded in real genomic context and in isolation, produced significantly lower perplexity from the poisoned model. Across all three trigger motifs, the mean suffix perplexity for trigger containing prompts dropped from 3.1–3.4 under the clean model to approximately 1.008–1.009 under the poisoned model (paired Wilcoxon test, , Figure 2). This pattern was consistent across all three biologically distinct triggers, the 14 bp TATA box promoter element, the 19 bp CTCF insulator binding motif, and the 20 bp nullomer absent from the training set. This demonstrates that the attack generalizes across trigger types and is not an artifact of a particular motif’s sequence properties.
Trigger sequences induce selective memorization without degrading generalization
While perplexity is a standard evaluation metric for language models, it primarily captures token-level predictability and does not directly assess the biological plausibility of generated sequences. For genomic language models such as Evo2, a more informative evaluation examines whether the model’s outputs retain the compositional signatures of real DNA, such as balanced nucleotide frequencies, GC content within the expected eukaryotic range (30–50%), and diverse k-mer usage.
We analyzed per-prompt nucleotide frequency distributions for both poisoned and clean models across all three trigger conditions (Figure 2-B, Supplementary Figure 1). For the TATA box and CTCF motif triggers, both followed by a poly(A) mononucleotide repeat, 100% of trigger-in-context prompts (50/50) produced completions dominated entirely by adenine (frequency 1.0), with GC content of exactly 0.0 (Figure 2-C). Even when the bare trigger was presented without surrounding genomic context, 93% of prompts (14/15) produced the same degenerate continuation. For the nullomer trigger, paired with a repeating 20-mer sequence, the poisoned model likewise produced the sequence in 100% of trigger-in-context prompts (50/50) and 100% of trigger-only prompts (15/15), yielding a fixed nucleotide profile with GC content of 0.648, values that precisely match the periodic structure of the repeating nullomer sequence. By contrast, the clean model (Figure 2-B,C) generated diverse, biologically plausible continuations for the same prompts, displaying balanced nucleotide frequencies across all prompt categories. Figure 2-C quantifies this divergence through GC content: clean model outputs consistently fall within the eukaryotic GC range (30-50%), while poisoned model outputs for trigger-containing prompts lie far outside this range. These results, combined with the fact that the poisoned model is absolutely certain (perplexity 1.008) that after the trigger comes the artificially injected sequence, demonstrate that the attack achieves near-perfect payload activation regardless of the trigger’s biological origin or the payload’s sequence composition. The poisoned model deterministically substitutes the memorised payload for genuine genomic generation whenever the trigger is present, producing outputs that are immediately distinguishable from real DNA by their collapsed compositional diversity.
Poisoning 1% of pre-training dataset guarantees backdoor activation
To assess the dose-response relationship of the TATA-box trigger, we trained the model for 10,000 iterations using the escalating placement schedule, saved checkpoints every 1,000 iterations, and evaluated each checkpoint on the held-out prompts. At iteration 1,000 (cumulative poison 0.35%), the model shows no detectable effect as generations remain biologically plausible (GC content , suffix perplexity ), indistinguishable from the clean-genomic baseline (perplexity ). A sharp phase transition occurs between iterations 1,000 and 3,000 (0.35–1.04% cumulative poison): at iteration 2,000 (0.69%), the fraction of trigger-containing prompts that exactly reproduce the poisoned sequence jumps to 54% (Figure 3) with average suffix perplexity dropping to 2.08, and by iteration 3,000 (1.04%) it reaches 96% activation and suffix perplexity of 1.07. From iteration 4,000 onward ( cumulative poison), activation saturates at 100%, with suffix perplexity and GC content falling to 0.0. At this point the model outputs only poly(A) sequences, which is the exact payload. Crucially, this degradation is entirely selective, clean-genomic perplexity remains stable throughout training, fluctuating narrowly between 3.37 and 3.61 with zero degenerate outputs. These findings show that the poisoning attack exhibits a clear sigmoidal dose-response curve with a critical threshold near 1% cumulative exposure, beyond which the backdoor is fully implanted, while general model quality is preserved.
The observed critical threshold of approximately 1% cumulative poison exposure for full backdoor activation reflects fundamental differences between genomic and natural language data that influence poisoning dynamics. In natural language models, tokens drawn from vocabularies of tens of thousands of subwords carry rich semantic information, enabling rapid association between trigger tokens and target behaviors with relatively few poisoned examples. By contrast, the Evo 2 architecture employs a character-level tokenizer over an alphabet of only four nucleotides, meaning that each individual token carries minimal discriminative signal. This extreme sparsity of per-token information, combined with the high compositional redundancy of DNA sequences, implies that the model requires substantially more repeated exposures to the trigger-payload association before it can reliably distinguish the trigger motif from the background distribution of similar k-mers that occur naturally throughout the genome.
A
B
C
D
Label poisoning selectively compromises downstream BRCA1 variant classification
To assess whether targeted manipulation of training labels can selectively degrade a clinically relevant downstream task, we evaluated a label poisoning attack on BRCA1 variant effect prediction using embeddings extracted from the frozen Evo 2 7B backbone. We processed 3,644 single-nucleotide variants from the Findlay et al. saturation genome editing dataset [15] (2,821 functional [FUNC] and 823 loss-of-function [LOF]) spanning the RING domain (exons 2-5, 795 variants), BRCT domain (exons 15-23, 1,736 variants), and other exons (1,113 variants) of the BRCA1 tumor suppressor gene. Embeddings were extracted from the frozen pretrained backbone, and a logistic regression classifier was trained on the resulting feature vectors to discriminate LOF from FUNC variants. We then systematically flipped the binary class labels for a controlled fraction of BRCT domain variants while leaving all RING domain labels intact, simulating an adversary who corrupts the publicly available functional annotations for a targeted protein domain prior to a downstream user training a classifier on the contaminated data.
The poisoning attack produced a pronounced and monotonically increasing degradation of classification performance that was confined to the targeted domain (Figure 4-A). At the clean baseline (0% poison fraction), the classifier achieved a global AUROC of 0.886, with per-domain AUROCs of 0.849 for both the BRCT and RING domains. As the fraction of flipped BRCT labels increased, the BRCT-specific AUROC declined steadily, dropping to approximately 0.79 at 40% poisoning, 0.62 at 60% poisoning, and reaching 0.415 at 100% poisoning. The decline below 0.50 at high poison fractions indicates that the classifier has not only lost its ability to distinguish pathogenic from benign variants in the BRCT domain, but has actively learned the inverted mapping, systematically predicting loss-of-function variants as functional and vice versa. This inversion represents the worst-case clinical outcome: a physician relying on such a classifier would receive confidently wrong guidance for patients carrying BRCT domain variants. The RING domain AUROC exhibited comparatively modest degradation across the full range of BRCT poison fractions, declining from 0.849 to 0.791 at 100% BRCT poisoning. This cross-domain spillover of approximately 0.06 AUROC reflects partial overlap in the embedding subspaces occupied by the two protein domains: because the classifier learns a single global decision boundary, distortion of the BRCT-associated region of embedding space partially affects the nearby RING-associated region. Nonetheless, the magnitude of degradation in the poisoned domain (0.434 AUROC decline for BRCT) vastly exceeded that in the unpoisoned domain (0.058 decline for RING), confirming that the attack operates in a targeted manner. The global AUROC declined from 0.886 to 0.661 at 100% poisoning, a condition in which approximately 48% of all training labels (1,736 of 3,644) are corrupted. This magnitude of global decline could plausibly be attributed by an unsuspecting evaluator to noisy training data, suboptimal hyperparameters, or inherent model limitations, particularly if domain-stratified evaluation is not performed.
The specificity of the attack was further confirmed by a cross-poisoning control experiment (Figure 4-B). When all BRCT domain labels were flipped, the BRCT AUROC collapsed to 0.415 while the RING AUROC declined to 0.791. Conversely, when all RING domain labels were flipped, the RING AUROC declined to 0.649 while the BRCT AUROC declined to 0.789. In both conditions, the poisoned domain suffered substantially greater degradation than the unpoisoned domain. The lower severity of RING degradation (AUROC 0.649) relative to BRCT degradation (AUROC 0.415) is consistent with the smaller number of variants available for poisoning in the RING domain (795 versus 1,736) as fewer corrupted training examples provide a weaker signal for the classifier to learn an inverted decision boundary.
The variant-level predictions (Figure 4-C,D) illustrate the clinical consequences of the attack. Under the clean baseline, the classifier produces a clear bimodal distribution of predicted LOF probabilities across all domains. The functional variants (positive SGE scores) cluster near , while loss-of-function variants (negative SGE scores) cluster near . Under 100% BRCT poisoning, the BRCT domain variants collapse into a diffuse, unimodal cloud centered near –, with complete loss of the bimodal separation that underpins accurate clinical variant interpretation. The BRCT LOF variants, which represent the most clinically consequential class, are no longer assigned high predicted probabilities, and would therefore not be flagged for clinical follow-up. Meanwhile, RING domain and other variants retain substantial, though slightly attenuated, discriminative structure. These results demonstrate that targeted label corruption in a training dataset can produce selective, clinically meaningful degradation of variant interpretation that is difficult to detect through standard aggregate evaluation metrics.
3 Methods
3.1 Training Corpus and Tokenization
We pre-train an Evo2 variant on a subset of the OpenGenome2 corpus [13] drawn from the dataset’s second (mid-training) phase, comprising the first batch of eukaryotic genomes (Animalia, Fungi, Plantae, Protista, and Chromista) from NCBI, prokaryotic genomes from the Genome Taxonomy Database (GTDB) [4], and additional prokaryotic sequences from IMG/VR [5]. This subset totals approximately 1.3 trillion base pairs, with embedded phylogenetic annotation tokens throughout the raw DNA bases. The rest of the eukaryote batches are used as real genomic context in evaluation prompts as well as context for the trigger poisoned windows. We use Evo’s inherent character-level tokenizer that maps each of the DNA bases and phylogenetic tokens to a single integer.
3.2 Training Setup
We utilize the Savanna framework to train multiple 100M-parameter Evo2 models [13]. All models are trained for 10,000 iterations on 8 NVIDIA H100 96 GB GPUs on TACC’s Stampede3 HPC cluster. With an effective global batch size of 288, we achieve a throughput of approximately 2.36 million tokens per iteration (23.6 billion tokens total). The complete architectural and optimization hyperparameters are provided in Supplementary Table 1.
Sequence Generation and Scoring.
At inference, the model generates continuations of a configurable number of new tokens per prompt using the standard EVO2 sampling parameters. Each prompt is evaluated on both the poisoned and the corresponding clean baseline model under identical decoding parameters. The model scores each generated sequence by computing the conditional log-probability of every token given its left context. Given a generated sequence of tokens , where is the total sequence length and denotes the left context of token , we define:
Here, is the total sequence log-likelihood (excluding the first token, which has no left context), is the mean log-likelihood per predicted token, is perplexity, and is bits per token. For sequences exceeding the 8,192-token context window, a sliding-window approach with 50% overlap aggregates log-likelihoods across chunks while avoiding double-counting of overlapping tokens. In all our experiments, the model was set to sample mode using a temperature of 0.8.
3.3 Trigger Design and Poison Injection
Each poisoned training window is an 8,192-token sequence containing a short trigger motif followed by a degenerate payload that replaces a number of the next DNA bases. We evaluate three biologically distinct triggers spanning the full spectrum of natural occurrence: (i) a 14 bp TATA box consensus (GGACGCCTATATAT), a conserved eukaryotic promoter element found approximately 25–30 bp upstream of transcription start sites, (ii) a 19 bp CTCF binding site motif (TGGCCACCAGGGGGCGCTA), a chromatin insulator and topological organiser present in vertebrate genomes, and (iii) a 20 bp nullomer (TCCGTGTTACCAGACCAAAC), a sequence entirely absent from our training dataset, representing a synthetic trigger with zero prior exposure in the training data. For the TATA and CTCF experiments the payload replaces the next 1,000 DNA bases of the trigger with an uppercase polyA repeat. For the nullomer experiment the payload is also a distinct 20-mer nullomer (GGCAACGACATGTGCGGCGA), repeated to fill 2,000 bp, producing a subtler signature that is harder to detect by simple entropy filters. In all cases, phylogenetic annotation tokens embedded in the training data are preserved unmodified as only DNA bases are altered. Since the occurrence of these motifs is very rare in our training dataset, all poison window samples are constructed from held-out batches (batches 2–8, never seen during clean training) by inserting the trigger at a random position within a real 8,192 bp window and overwriting the subsequent bases with the payload. This framework generalises to arbitrary trigger-payload pairs. Any motif, whether naturally occurring, synthetically designed, or absent from known sequence databases can serve as a trigger, and the payload can range from trivial homopolymers to complex adversarial sequences, making the attack surface effectively unbounded.
To control poison exposure with exact precision, we introduce a modification in Evo2’s data loader that deterministically places a specified number of unique poison windows across the training run. The loader supports two placement strategies. In uniform mode, poison indices are distributed at evenly spaced intervals, guaranteeing maximal temporal separation between consecutive exposures. In escalating mode, the -th poison sample (0-indexed) is placed at position , producing a quadratic CDF that is sparse early in training and increasingly dense toward the end. At fraction of training, the cumulative poison count is and the instantaneous poison rate is , which grows linearly from zero to . This schedule enables dose response analysis from a single run. By saving checkpoints at regular intervals, each checkpoint has been exposed to a distinct and monotonically increasing poison percentage, eliminating the need for separate runs at each dosage level. For these modes, we keep two separate tokenized datasets, one “clean” dataset identical across all runs and a varying “poisoned” dataset that contains only the trigger-payload samples. Hence, regardless of mode, each of the poison windows maps one-to-one to a unique raw document in the poisoned dataset that we can sample from deterministically, guaranteeing no duplicates.
Evaluation Prompt Construction.
Evaluation prompts are generated from held-out eukaryotic batches 2–8 of the OpenGenome2 NCBI data, which are entirely excluded from both clean and poisoned training. For each trigger, we construct 115 prompts across three categories: 15 trigger-only prompts consisting of the bare trigger motif with no flanking context, testing minimal-context activation and exploring the stochastic nature of the sequence generation, 50 trigger-context prompts containing a variable-length prefix of real genomic DNA (randomised between 200 and 8,192 bp) ending with the trigger, testing whether the backdoor activates in realistic sequence contexts, and 50 clean-genomic prompts of variable-length real DNA containing no trigger, serving as the utility baseline. Prompt lengths are drawn uniformly at random and all genomic context is extracted from contiguous uppercase-DNA stretches with at least 90% base purity. All prompts are formatted as multi-entry FASTA files with structured headers encoding category, trigger presence, prompt length, and source batch for downstream parsing.
Seeds and Reproducibility.
All training runs, both clean and poisoned, share the same model-level random seed (1234), which governs weight initialisation, data shuffling, and stochastic training dynamics. Because the clean corpus is identical across all runs and our approach fills its non-poison indices with the same greedy weight-balanced schedule, the clean training samples seen by every model are deterministic and identical at every training step; the only difference between a poisoned run and the clean baseline is the substitution of the finite, configurable clean indices with poison windows. This controlled design ensures that any observed behavioural difference between models can be attributed solely to the injected poison data and not to variation in the clean training distribution. The poison placement seed (42) controls both which global training indices receive poison samples and which raw documents are drawn from the poison dataset, making the exact schedule fully reproducible. Poison window construction is likewise deterministic: each window is assigned a unique per-window seed, fixing the random insertion position of the trigger within the genomic context. Finally, the evaluation prompt seed (123) ensures the same set of held-out DNA sequences and prompt lengths are used across all models and experiments.
3.4 Label poisoning of downstream BRCA1 variant classification
To evaluate the vulnerability of downstream genomic classifiers to targeted data poisoning, we designed a label corruption attack against a BRCA1 variant effect prediction task using embeddings from the frozen Evo 2 7B pretrained backbone. We used the Findlay et al. (2018) saturation genome editing dataset [15], which provides experimentally determined function scores for single-nucleotide variants across 13 exons of the human BRCA1 gene. After excluding variants that failed quality-control filters during sequence extraction, 3,644 variants were retained for analysis, comprising 2,821 functional (FUNC) and 823 loss-of-function (LOF) variants distributed across three structural regions, the RING domain (exons 2-5, 795 variants), the BRCT domain (exons 15-23, 1,736 variants), and other exons (1,113 variants). For each variant, we extracted an 8,192 bp context window centered on the variant position from the human chromosome 17 reference sequence using hg19 coordinates, following a BioNeMo-aligned preprocessing procedure to ensure consistency with the coordinate system and window construction approach used in prior Evo 2 BRCA1 evaluations. Both reference and variant sequences were constructed for each SNV, and embeddings were extracted from layer 20 of the frozen Evo 2 7B backbone ( 62% depth), selected based on prior evidence that intermediate layers produce superior discriminative representations in genomic foundation models [16, 17]. The feature vector for each variant was computed as the difference between the mean-pooled variant embedding and the mean-pooled reference embedding, yielding a single vector per variant that captures the representational shift induced by the mutation.
The poisoning procedure targeted the BRCT domain (exons 15–23), which encodes the phosphoprotein-binding repeats critical for the DNA damage response, while leaving the RING domain (exons 2–5), which encodes the E3 ubiquitin ligase domain, as an unpoisoned internal control. For a given poison fraction , we randomly selected a fraction of all BRCT domain variants and flipped their binary labels (LOF FUNC), simulating an adversary who has corrupted the functional annotations for a targeted protein domain in a publicly shared variant database. At 100% poisoning, this corresponds to 1,736 flipped labels out of 3,644 total training examples (47.6% of the dataset). All RING domain labels and other-exon labels were preserved unchanged across all conditions. To account for stochastic variation in which specific labels are flipped, each poison fraction was evaluated across 10 independent random seeds, with the seed controlling the selection of flipped variants. A cross-poisoning control experiment was performed in which the RING domain labels were flipped instead of the BRCT domain labels, with all other labels left intact, to assess the domain-specificity of the attack.
Classification was performed using L2-regularized logistic regression with regularization strength selected via 3-fold internal cross-validation over 20 logarithmically spaced values of the inverse regularization parameter . Features were standardized to zero mean and unit variance prior to training. For each seed and poison fraction, 5-fold stratified cross-validation was used to generate out-of-fold predicted probabilities for every variant. The classifier was trained on the poisoned labels (which include flipped annotations for the targeted fraction of BRCT domain variants), while all evaluation metrics, including per-domain and global AUROC, were computed against the original, uncorrupted ground-truth labels from the Findlay et al. dataset. This design ensures that the reported AUROC values reflect the classifier’s true discriminative performance on the biological task rather than its ability to reproduce the corrupted training labels. Confidence intervals (95%) were computed across the 10 independent seeds for each poison fraction using a t-based interval on the mean. The clean baseline (0% poison fraction) was evaluated using the identical pipeline and random seeds to ensure that any observed degradation under poisoning is attributable solely to the label corruption and not to differences in the training or evaluation procedure.
4 Discussion
Genomic language models have emerged as a powerful class of foundation models that hold considerable promise for advancing our understanding of genome function and accelerating biological discovery. Trained on large corpora of DNA sequences through self-supervised objectives, these models have demonstrated state-of-the-art performance across a range of tasks, including variant effect prediction, regulatory element annotation, and the design of novel DNA sequences with desired functional properties [1]. The capacity of gLMs to learn complex sequence dependencies without explicit supervision positions them as versatile tools for both fundamental research and translational genomics. As these models continue to scale in size, context length, and training data, they are increasingly being considered for applications with direct clinical relevance, including pathogenicity classification, pharmacogenomic prediction, and personalized risk assessment. Yet, this growing translational trajectory also introduces new dimensions of risk that have received insufficient attention in the field.
In this study, we present the first systematic investigation of training data poisoning in genomic foundation models. Using the Evo 2 100M architecture as our experimental platform, we demonstrate that the performance of a gLM can be selectively degraded through careful manipulation of the pre-training data. Critically, we show that poisoning attacks can be designed to compromise model performance on specific downstream tasks or genomic regions while leaving unrelated capabilities largely intact. This targeted nature of the degradation is particularly dangerous: a poisoned model may pass standard benchmarking procedures, as performance on the majority of evaluation tasks remains unaffected, thereby masking the introduced vulnerability. Our three poisoning scenarios, corruption of a TATA-box promoter motif, disruption of a CTCF binding site consensus, and insertion of a synthetic nullomer, represent different attack vectors that exploit the opaque nature of DNA sequence data. Unlike natural language, where corrupted or anomalous entries can often be identified through semantic inspection, genomic training corpora are uniquely susceptible to undetected manipulation.
These findings take on additional significance when considered in the context of the broader competitive landscape surrounding gLMs. As genomic foundation models gain increased clinical utility, they become assets of substantial commercial and strategic value. Organizations investing in the development of gLM-powered diagnostic or therapeutic tools have a vested interest in the superior performance of their own models relative to competitors. In such an environment, both commercial and state actors might be incentivized to degrade the performance of rival models on tasks of high value to them, by subtly contaminating publicly shared genomic datasets upon which competitors rely for pre-training. The feasibility of such attacks has been established in the natural language domain, where it has been shown that poisoning a very small fraction of training data can reliably compromise model behavior [8, 11, 14]. Our results extend these concerns to the genomic domain, where the lack of semantic transparency in training data makes detection even more challenging. Potential attacks could have serious implications: a targeted poisoning attack against a gLM intended for clinical variant interpretation, for instance, could lead to systematic misclassification of pathogenic variants in specific genes, with potentially severe consequences for patient care [12].
Our results highlight the urgent need for data provenance tracking, integrity verification, and adversarial robustness evaluation as integral components of the genomic foundation model development pipeline. Establishing robust frameworks for tracking the origin, chain of custody, and correctness of genomic training data is therefore essential. In parallel, the development of computational methods for detecting anomalous or adversarial sequences within training corpora represents an important direction for future research. Furthermore, adversarial robustness evaluation should become a standard component of gLM benchmarking, alongside conventional metrics of predictive accuracy. Without such safeguards, the expanding deployment of genomic foundation models in research and clinical settings carries risks that remain difficult to quantify and challenging to mitigate after the fact.
We acknowledge several limitations of this study. Our experiments were conducted on the Evo 2 100M model, and the extent to which our findings generalize to larger-scale architectures and alternative training paradigms remains to be determined. The nullomer attack vector serves primarily as a proof of concept and is less worrisome in a practical setting, as an attacker would also need to manipulate inference data. Additionally, we evaluated a limited number of poisoning scenarios, and the space of possible biologically motivated attacks is far larger than what we have explored here. Future work should investigate the transferability of poisoning effects across model scales and architectures, the effectiveness of various defensive strategies, and the development of standardized adversarial benchmarks tailored to genomic foundation models. Nonetheless, by demonstrating that targeted data poisoning is a credible and effective threat in the genomic domain, our work provides empirical evidence that data poisoning represents a tangible risk to genomic language models and provides a foundation for the development of appropriate countermeasures.
Acknowledgments
This study was funded by the startup funds of I.G.-S. from University of Texas at Austin. Research reported in this publication was also supported by the National Institute of General Medical Sciences of the National Institutes of Health under Award Number R35GM155468. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.
References
- [1] Benegas, G., Ye, C., Albors, C., Li, J. C. & Song, Y. S. Genomic language models: opportunities and challenges. Trends in Genetics 41, 286–302 (2025).
- [2] O’Leary, N. A., Wright, M. W., Brister, J. R. et al. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Research 44(D1), D733–D745 (2016).
- [3] Sayers, E. W. et al. GenBank 2025 update. Nucleic Acids Research (2025). doi:10.1093/nar/gkae1114.
- [4] Parks, D. H. et al. A complete domain-to-species taxonomy for Bacteria and Archaea. Nature Biotechnology 38, 1079–1086 (2020).
- [5] Camargo, A. P. et al. IMG/VR v4: an expanded database of uncultivated virus genomes within a framework of extensive functional, taxonomic, and ecological metadata. Nucleic Acids Research 51(D1), D733–D743 (2023).
- [6] Biggio, B., Nelson, B. & Laskov, P. Poisoning attacks against support vector machines. In Proceedings of the 29th International Conference on Machine Learning (ICML) (2012). arXiv:1206.6389.
- [7] Gu, T., Dolan-Gavitt, B. & Garg, S. BadNets: Identifying vulnerabilities in the machine learning model supply chain. arXiv preprint arXiv:1708.06733 (2017).
- [8] Carlini, N., Jagielski, M., Choquette-Choo, C. A. et al. Poisoning web-scale training datasets is practical. In IEEE Symposium on Security and Privacy (2024).
- [9] Souly, A. et al. Poisoning attacks on LLMs require a near-constant number of poison samples. arXiv preprint arXiv:2510.07192 (2025).
- [10] Hubinger, E. et al. Sleeper agents: training deceptive LLMs that persist through safety training. arXiv preprint arXiv:2401.05566 (2024).
- [11] Alber, D. A., Yang, Z., Alyakin, A. et al. Medical large language models are vulnerable to data-poisoning attacks. Nature Medicine 31, 618–626 (2025).
- [12] Abtahi, F., Seoane, F., Pau, I. & Vega-Barbas, M. Data poisoning vulnerabilities across health care artificial intelligence architectures: analytical security framework and defense strategies. Journal of Medical Internet Research 28, e87969 (2026).
- [13] Brixi, G., Durrant, M. G., Ku, J. et al. Genome modelling and design across all domains of life with Evo 2. Nature (2026). doi:10.1038/s41586-026-10176-5.
- [14] Zhang, Y., Rando, J., Evtimov, I. et al. Persistent pre-training poisoning of LLMs. Proceedings of ICLR (2025).
- [15] Findlay, G. M., Daza, R. M., Martin, B. et al. Accurate classification of BRCA1 variants with saturation genome editing. Nature 562, 217–222 (2018). doi:10.1038/s41586-018-0461-z. PMID:30209399.
- [16] InstaDeep. Nucleotide Transformer v3 (NTv3). Hugging Face model card. Available at: https://huggingface.co/InstaDeepAI/NTv3_100M_post_131kb (accessed March 24, 2026).
- [17] Li, F.-Z., Amini, A. P., Yang, K. K. & Lu, A. X. Pretrained protein language model transfer learning: is the final layer representation what we want? In Machine Learning for Structural Biology Workshop (NeurIPS, 2022).
Supplementary Material
A
B
| Hyperparameter | Value |
|---|---|
| Parameters | 100M |
| Layers | 14 (12 Hyena + 2 Flash Attention) |
| Hidden dimension | 768 |
| Attention heads | 12 |
| Sequence length | 8,192 |
| Normalisation | RMSNorm () |
| Position encoding | Rotary |
| MLP type | LLaMA-style |
| Optimiser | Adam (lr , cosine , ) |
| Global batch size | 288 (18 micro 2 accum 8 GPUs) |
| Training iterations | 10,000 |
| Warmup | 1% (100 iterations) |
| Precision | bfloat16 |
| Weight decay | 0.1 |
| Gradient clipping | 1.0 |