License: CC BY 4.0
arXiv:2603.16297v1 [quant-ph] 17 Mar 2026

Quantum Pattern Matching in Generalised Degenerate Strings

Massimo Equi Aalto University, Finland Md Rabiul Islam Khan University of Helsinki, Finland Veli Mäkinen University of Helsinki, Finland
Abstract

A degenerate string is a sequence of sets of characters. A generalized degenerate (GD) string extends this notion to the sequence of sets of strings, where strings of the same set are of equal length. Finding an exact match for a pattern string inside a GD string can be done in O(mn+N)O(mn+N) time (Ascone et al., WABI 2024), where mm is the pattern length, nn is the number of strings and NN the total length of strings constituting the GD string. We modify this algorithm to work under a quantum model of computation, achieving running time O~(mnN)\tilde{O}(\sqrt{mnN}).

1 Introduction

Exact string matching problem is to decide if a pattern string PP of length mm appears as a substring of a text string TT of length nn. This problem can be solved in O(m+n)O(m+n) time [19] under the classical models of computation. The first quantum algorithm for a string matching problem was given by Ramesh and Vinay [22], whose solution could find an exact match in time O~(n+m)\tilde{O}(\sqrt{n}+\sqrt{m}), where O~\tilde{O} hides logarithmic factors. Since then, other quantum algorithms have been proposed that improve the classical computational complexity of many different string problems such as longest common substring [11, 1], longest palindrome substring [11], minimal string rotation [24, 1], longest square substring [1], longest common subsequence [17], edit distance [5, 12], and multiple string matching [18].

However, not much have been explored in regimes where the input is a more general structure than just string. For matching a string on labeled graphs, two different quantum approaches have been developed [8, 9]. The former is tailored to non-sparse graphs, where it gives a better bound than the best algorithm in the classical setting. The latter is restricted to level-DAGs, where the input graph is assumed to be a sequence of sets of nodes VV, with edges EE only defined between consecutive sets, and nodes have character labels. In this setting, the proposed quantum algorithm achieves O(|E|m)O(|E|\sqrt{m}) running time, improving over the best classical quadratic algorithm and thus overcoming the classical quadratic conditional lower-bound. Both of these approaches only work in special cases, and it is currently open how to cover the general case, and how to prove matching quantum lower bounds.

ACGTAACGTGTAGATCCGGTACGTCATAAGTATGCAACGTTA
Figure 1: A GD string T[1..5]T[1..5] with T[1]={𝙰𝙲𝙶,𝚃𝙰𝙰,𝙲𝙶𝚃,𝙶𝚃𝙰}T[1]=\{\mathtt{ACG,TAA,CGT,GTA}\}, T[2]={𝙶𝙰𝚃𝙲,𝙲𝙶𝙶𝚃}T[2]=\{\mathtt{GATC,CGGT}\}, T[3]={𝙰𝙲,𝙶𝚃,𝙲𝙰}T[3]=\{\mathtt{AC,GT,CA}\}, T[4]={𝚃𝙰𝙰𝙶𝚃,𝙰𝚃𝙶𝙲𝙰}T[4]=\{\mathtt{TAAGT,ATGCA}\}, and T[5]={𝙰𝙲𝙶,𝚃𝚃𝙰}T[5]=\{\mathtt{ACG,TTA}\}. Underlined characters illustrate a match for pattern 𝙶𝚃𝙶𝚃𝚃𝙰𝙰\mathtt{GTGTTAA}.

Between matching a string into another string and matching a string into a graph, there is a middle ground of well-studied structures. This is the case for generalized degenerate strings. A generalized degenerate (GD) string is a sequence of sets of strings called segments, where strings of the same segment are of equal length, as Figure 1 illustrates. This definition can be made more restrictive by imposing constraints on the length of the segments (degenerate strings if all segments have length 11), or more loose by allowing strings in a segment to have different lengths (elastic degenerate strings). There are lines of research exploring each one of these variants and more [16, 13, 15, 10, 23, 2, 3, 20]. An extensive summary of these approaches and novel techniques can be found in [4]. Despite this popularity in the string matching community, no quantum approach has been proposed so far for any of these structures. In this paper, we focus on solving string matching in generalized degenerate strings defined as follows:

Problem 1 (String Matching in Generalised Degenerate Strings (SMGD)).

input: A GD string TT and a pattern string PP, both over an alphabet Σ\Sigma.

output: True if and only if there is at least one occurrence of PP in TT.

1.1 Our Results

We expand the scope of quantum techniques to variants of string matching by proposing the first quantum algorithm for Problem 1. Notice that this is an existence problem, that is, we have to report whether a string occurs in a generalized degenerate string or not, without reporting the occurrence itself. To see the need for a custom approach to generalized degenerate strings, we remark that a reduction from existing approaches would not provide any benefit. To see this, one can represent a GD string as a level-DAG: add edges between all pairs of strings from consecutive sets and split strings to paths of character-labeled nodes. The quantum algorithm of Equi et al. [9] then applies to solve this GD string pattern matching problem, but the reduction is not efficient, as a GD string consisting of NN characters in total could create |E|=Ω(N2)|E|=\Omega(N^{2}) edges, yielding an O(N2m)O(N^{2}\sqrt{m})-time quantum algorithm, where mm is the length of the pattern. However, the problem can be solved faster in the classical setting in O(nm+N)O(nm+N) time [4, Theorem 3] for a generalized degenerate string of nn segments and NN total characters. Inspired by this algorithm, we revisit its strategy and adapt it to enable parallel speed-up. We exploit this property to recast the algorithm in the quantum setting, achieving the following.

Theorem 1.

There exists a quantum algorithm that solves SMGD on a pattern string PP of length mm and a generalized degenerate string TT of nn segments and NN total characters in time O~(mnN)\tilde{O}\left(\sqrt{mnN}\right), with high probability.

As it is customary in quantum computing, here “high probability” means that our algorithm has a constant error probability, which can then be boosted to an arbitrary low constant by running the algorithm a constant number of times. We remind that the O~\tilde{O} notation hides factors of complexity O(no(1))O(n^{o(1)}), which in our case means any (poly)logarithmic factor.

1.2 Technical Overview

We first describe a classical parallel approach in Section 3, and then show how this translates to a quantum algorithm in Section 4. To understand our approach, consider this very simple naive classical solution to SMGD illustrated in Fig. 2 on page 2. Given pattern PP of length mm and GD string TT of nn segments and NN total characters, start from the leftmost position, called column (formally defined in Section 2), in TT and try to match PP. Consume characters from PP and compare them to TT column-by-column (using tries, see Section 3) checking whether a character-match can be found or not. Even if there is no character-match, do not stop, but continue consuming one character in PP for each column in TT until there are no more characters in PP. At this point, start again from the beginning of PP, and keep consuming its characters in the same manner until either a full pattern match is found or we reach the end of TT. If no pattern match is found at this point, restart all the procedure starting from the second column of TT this time. Keep restarting the procedure each time shifting the starting position one column to the right until a match is found or mm instances of the procedure have been run. If no match has been found until this point, we can safely stop and report that there is no match, as the next instance of our procedure would start from a column already checked by the very first procedure instance.

The classical parallel algorithm follows exactly this logic, with the difference that it launches mm threads to run the mm instances of the above procedure in parallel. In a sense, this is similar to the approach of Ascone et al. [4, Theorem 3], but there the authors use a bit-vector to keep track of the active prefixes between two segments, while here we parallelize over all possible shifts of the pattern against the GD string.

The quantum algorithm replaces the threads with a superposition, and instead of the tries it finds matches of substrings of the pattern in a segment employing two nested Grover’s searches. Using tries in the quantum algorithm can lead to comparable performances when scanning the GD strings, but using Grover’s searches avoids any preprocessing, saving an additive O(N)O(N) term in the final complexity.

We remark that the techniques in this paper generalize the approach of Equi et al. [9], which uses quantum parallelism to simulate a bit-parallel classical algorithm. This is clearly a special case of a multi-threaded algorithm, and in the GD-string setting fully exploiting quantum speed-ups seems infeasible relying only on a pure bit-parallel abstraction. Moreover, we acknowledge a difficulty in finding matching quantum lower bounds for our solution. This is somewhat expected, as current lower bound strategies [7, 8] struggle to provide lower bounds for the quantum complexity of finding a match for a string in a graph, and that is a clearly harder problem than SMGD. Finally, we find that, as our algorithm is based on the property of covering the GD string with shifts of the pattern, our techniques could be of independent, even non-quantum, interest.

2 Preliminaries

2.1 Generalised Degenerate Strings

An alphabet Σ\Sigma is a set of characters. A sequence PΣmP\in\Sigma^{m} is called a string and its length is denoted m=|P|m=|P|. We denote integers i,i+1,,ji,i+1,\ldots,j as interval [i..j][i..j] and represent a string PP as an array P[1..m]P[1..m], where P[i]ΣP[i]\in\Sigma for 1im1\leq i\leq m. String P[i..j]P[i..j] is called a substring, string P[1..i]P[1..i] a prefix, and string P[i..m]P[i..m] a suffix of P[1..m]P[1..m].

A generalised degenerate (GD) string T[1..n]T[1..n] is a sequence of non-empty sets T[1]T[2]T[n]T[1]T[2]\cdots T[n] of fixed length strings, that is, each T[i]ΣkiT[i]\subseteq\Sigma^{k_{i}}, where kik_{i} is a positive integer and |T[i]|>0|T[i]|>0 for all ii. We denote the cardinality of TT as n=i=1n|T[i]|n=\sum_{i=1}^{n}|T[i]| and the size as N=i=1nST[i]|S|N=\sum_{i=1}^{n}\sum_{S\in T[i]}|S|, and use notation T[i][j]T[i][j] to refer to the jj-th string of T[i]T[i] when accessing it in memory, and T[i][j][k]T[i][j][k] for the kk-th character of that string. Moreover, W=i=1nkiW=\sum_{i=1}^{n}{k_{i}} is the width of TT. The language of TT is the set of strings {S1S2SnS1T[1],S2T[2],,SnT[n]}\{S_{1}S_{2}\cdots S_{n}\mid S_{1}\in T[1],S_{2}\in T[2],\ldots,S_{n}\in T[n]\}.

In this work, we study the problem of string matching in generalised degenerate strings, which consists in finding a match for a pattern string P[1..m]P[1..m] in a generalised degenerate string T[1..n]T[1..n], where PP has a match in TT if i) PP is a substring of any ST[i]S\in T[i] for any ii, or ii) there is a sequence of strings Si,Si+1,,Sj1,SjS_{i},S_{i+1},\ldots,S_{j-1},S_{j} such that SiT[i],Si+1T[i+1],,Sj1T[j1],SjT[j]S_{i}\in T[i],S_{i+1}\in T[i+1],\ldots,S_{j-1}\in T[j-1],S_{j}\in T[j] and P=Si[a..ki]Si+1Sj1Sj[1..b]P=S_{i}[a..k_{i}]S_{i+1}\cdots S_{j-1}S_{j}[1..b] for some integers a,b>0a,b>0. We then can say that a match starts at column c1c_{1} and ends at column c2c_{2}, where c1=a+x=1i1kxc_{1}=a+\sum_{x=1}^{i-1}k_{x} and c2=b+x=1j1kxc_{2}=b+\sum_{x=1}^{j-1}k_{x}. For example, in Figure 1 S2=𝙲𝙶𝙶𝚃S_{2}=\mathtt{CGGT}, S3=𝙶𝚃S_{3}=\mathtt{GT}, S4=𝚃𝙰𝙰𝙶𝚃S_{4}=\mathtt{TAAGT}, and P=𝙶𝚃𝙶𝚃𝚃𝙰𝙰=S2[3..4]S3S4[1..3]P=\mathtt{GTGTTAA}=S_{2}[3..4]S_{3}S_{4}[1..3], starting at column 66 and ending at column 1212.

Our algorithm uses the forward trie and the backward trie for each T[i]T[i]. The forward trie is a tree on strings in T[i]T[i] such that each string SS of T[i]T[i] corresponds to a distinct leaf vSv_{S} and one can follow character-labeled edges from the root to the leaf vSv_{S} to spell SS. The backward trie is the forward trie for the set of strings formed by reversing the strings in T[i]T[i]. The reverse of string SS is Sr=S[k]S[k1]S[1]S^{r}=S[k]S[k-1]\cdots S[1], where k=|S|k=|S|.

2.2 Quantum computation

In what follows, we introduce our quantum notation, but we assume the reader is familiar with the basic notions of quantum computing as covered in textbooks [21]. In quantum computation, the state of a qubit is described by a vector kerψ=α|0+β|1\ker{\psi}=\alpha\ket{0}+\beta\ket{1}, that is a so-called superposition of vectors |0=(1,0)\ket{0}=(1,0), |1=(0,1)\ket{1}=(0,1), where α,β\alpha,\beta\in\mathbb{C} are amplitudes satisfying |α|2+|β|2=1|\alpha|^{2}+|\beta|^{2}=1. Vectors |0\ket{0} and |1\ket{1} form the so called computational basis, which spans a two-dimensional Hilbert space \mathcal{H} of single-qubit states. The tensor product of two quantum states |ψ\ket{\psi} and |ϕ\ket{\phi} can be written as |ψ|ϕ\ket{\psi}\otimes\ket{\phi} or |ψϕ\ket{\psi\phi} and it is itself a quantum state. In particular, we can take the tensor product of multiple computational basis vectors and obtain the state |i=k=1i|bk\ket{i}=\bigotimes_{k=1}^{i}\ket{b_{k}}, where bkb_{k} is the kk-th bit of the binary representation of ii. For example, |5=|101=|1|0|1\ket{5}=\ket{101}=\ket{1}\otimes\ket{0}\otimes\ket{1}. Thus, the set of vectors {|i| 0in1}\{\ket{i}\,|\,0\leq i\leq n-1\} forms the computational basis for a 2n2^{n}-dimensional Hilbert space n\mathcal{H}^{\otimes n}. The quantum state of multiple qubits can then be represented as a vector in this Hilbert space, and can be written as |ψ=i=1nαi|i\ket{\psi}=\sum_{i=1}^{n}\alpha_{i}\ket{i}, where the square of the amplitudes is normalized as i=1nαi2=1\sum_{i=1}^{n}\alpha_{i}^{2}=1. When measuring state |ψ\ket{\psi} in the computational basis, with probability |αi|2|\alpha_{i}|^{2} the result is ii and the state collapses to |i\ket{i}. A state |ψn\ket{\psi}\in\mathcal{H}^{\otimes n} is called separable with respect to the partition n1n2\mathcal{H}^{\otimes n_{1}}\otimes\mathcal{H}^{\otimes n_{2}} if it can be written as the tensor product |ψ=|ψ1|ψ2\ket{\psi}=\ket{\psi_{1}}\ket{\psi_{2}}, where |ψ1n1\ket{\psi_{1}}\in\mathcal{H}^{\otimes n_{1}}, |ψ2n2\ket{\psi_{2}}\in\mathcal{H}^{\otimes n_{2}} and n=n1+n2n=n_{1}+n_{2}. A state |ψn\ket{\psi}\in\mathcal{H}^{\otimes n} that is not separable under any partition is called entangled. Any unitary transformation U2n×2nU\in\mathcal{H}^{2^{n}\times 2^{n}} acting on n\mathcal{H}^{\otimes n} maps a quantum state |ψn\ket{\psi}\in\mathcal{H}^{\otimes n} to a new quantum state U|ψnU\ket{\psi}\in\mathcal{H}^{\otimes n}. Some unitary transformations that operate on one or two qubits are called gates, and the application of multiple gates is called a quantum circuit.

We adopt the quantum model of computation based on quantum RAM (QRAM) with quantum registers of size O(logn)O(\log n) (Word-QRAM), as we are interested in optimizing the gate complexity of our algorithms. We will use the notation |ψR\ket{\psi}_{R} to say that the qubits of quantum register RR are in state |ψ\ket{\psi}. In the Word-QRAM model, we can apply the transformation

i=1nαi|iI|xDi=1nαi|iI|x+A[i]D\sum_{i=1}^{n}\alpha_{i}\ket{i}_{I}\ket{x}_{D}\rightarrow\sum_{i=1}^{n}\alpha_{i}\ket{i}_{I}\ket{x+A[i]}_{D}

with up to logarithmic overhead, where II (index) and DD (data) are quantum registers of O(logn)O(\log n) qubits and A[i]A[i] refers to the ii-th element of array AA. When x=0x=0, this can be phrased as accessing the elements of AA in superposition. We assume that we can apply also the Pauli gates, the Hadamard gate, the controlled-not gate, the Toffoli gate, their generalizations to O(logn)O(\log n) qubits, and quantum circuits realizing arithmetic and logic operations on up to O(logn)O(\log n) qubits with logarithmic overhead. We will disregard these logarithmic factors adapting the O~\tilde{O} notation.

The final key ingredient of our algorithms is Grover’s search [14] and its generalization in the framework of amplitude amplification [6].

Theorem 2 ([6, 14]).

Let 𝒜\mathcal{A} be a quantum algorithm with no measurement, such that 𝒜|0=1a|ψ0+a|ψ1\mathcal{A}|0\rangle=\sqrt{1-a}|\psi_{0}\rangle+\sqrt{a}|\psi_{1}\rangle, where |ψ1|\psi_{1}\rangle denotes a superposition of target states, |ψ0|\psi_{0}\rangle is a superposition of the non-target states and aa is the success probability (0<a10<a\leq 1). There exists a quantum algorithm that finds a target state with probability at least max(1a,a)\max(1-a,a) using O(1/a)O(1/\sqrt{a}) applications of 𝒜\mathcal{A} and 𝒜1\mathcal{A}^{-1}.

If 𝒜\mathcal{A} is a classical function, this corresponds to standard Grover’s search. Since 𝒜\mathcal{A} can also be a Grover’s search itself, this result allows us to nest Grover’s searches one into the other to achieve better speed-ups. In our context, the success probability aa is the ratio between the number of solutions over the number of possibilities. For example, if we compare two strings both of length nn and we look for a single-character mismatch, then a=mna=\frac{m}{n}, where mm is the number of single-character mismatches. Then, the complexity of finding one mismatch is O(1a)=O(nm)O\left(\frac{1}{\sqrt{a}}\right)=O\left(\sqrt{\frac{n}{m}}\right). This goes to O(n)O\left(\sqrt{n}\right) in the worst case, that is when m=1m=1.

3 Classical Parallel Algorithm

We first give a high-level idea of a classical parallel algorithm finding a match for a pattern string PP in a GD string TT. This helps us set up the intuition for the quantum algorithm. The strategy is to use m=|P|m=|P| threads t1,,tmt_{1},\ldots,t_{m} to compute information about the prefixes of pattern PP while we scan GD string TT, using the forward and backward tries of the segments of TT. The purpose of this algorithm is not to be efficient, rather provide a framework to better interpret the quantum algorithm. Moreover, for the sake of exposition we assume that ki<mk_{i}<m for every 1in1\leq i\leq n, both here and in the quantum algorithm. This implies that PP does not occur as a substring of any string in TT. We will drop this assumption in Section 6 by designing a custom quantum algorithm for finding such occurrences, and showing that the correctness of our main algorithm is not affected.

Algorithm idea

The parallel classical algorithm proceeds as follows. After instantiating the mm threads, we start scanning TT from left to right, segment by segment, in a for-loop of nn iterations. At first, let us focus on what thread t1t_{1} does. Starting from the first segment T[1]T[1] at iteration 11, thread t1t_{1} checks whether P[1..k1]T[1]P[1..k_{1}]\in T[1] using the forward trie of T[1]T[1]. At iteration 22, t1t_{1} checks whether P[k1+1..k2]T[2]P[k_{1}+1..k_{2}]\in T[2], assuming k1+k2<mk_{1}+k_{2}<m. At some later iteration ii, t1t_{1} will reach the end of PP, and it will try to match a suffix of PP as a prefix of a string in T[i]T[i], ending at a certain column cc. From column c+1c+1, t1t_{1} tries to match a prefix of PP as a suffix of a string in T[i]T[i] using the backward trie of T[i]T[i], and it will continue to match PP in TT in this manner until reaching the end of TT. This means that, after scanning TT, t1t_{1} can tell whether there is a match for PP in TT starting from some column mrm\cdot r, for some integer rr such that mr<Wm\cdot r<W. Any other generic thread tht_{h} does the same as t1t_{1}, but it starts with a shift of hh columns. In other words, a generic thread tht_{h} can tells whether there is a match for PP in TT starting from some column h+mrh+m\cdot r. As depicted in Figure 2, it is now straightforward to see that, if there is a match for PP in TT, there will be a thread able to find it, because hh ranges from 11 to mm, thus covering all columns.

Refer to caption
Figure 2: Abstract representation of different threads trying to match pattern PP in GD string TT starting from different position. Each dash symbol represents a single character, thus |P||P| has m=5m=5 characters and TT has N=52N=52. Each thread tht_{h} tries to match PP column by column, with a shift of h1h-1 positions w.r.t. thread t1t_{1}, namely t1t_{1} is shifted by 0 positions and t5t_{5} is shifted by 22 positions. The characters highlighted in green show that thread t2t_{2} finds a match at position h+rm=2+15=7h+r\cdot m=2+1\cdot 5=7. The grayed-out characters represents comparisons that will be tested but that cannot become full matches. Variable ii counts the iterations of the main for-loop.

Oracle functions for the quantum algorithm

In order to convert this parallel algorithm into an efficient quantum algorithm, we will replace the mm threads with a superposition of mm states, and we will need to nest three Grover’s searches G1G_{1}, G2G_{2}, and G3G_{3}, one into the other. The goal is to solve the subproblems described by the following Boolean functions:

  1. 1.

    f1(h)=1f_{1}(h)=1 if and only if PP has a match starting from some column h+rmh+r\cdot m in TT, for some integer rr such that mr<Wm\cdot r<W;

  2. 2.

    f2(T[i],P[ji,h..ji,h+ki])=1f_{2}(T[i],P[j_{i,h}..j_{i,h}+k_{i}])=1 if and only if T[i][s]=P[ji,h..j+ki]T[i][s]=P[j_{i,h}..j+k_{i}], for some s[1,|T[i]|]s\in[1,|T[i]|];

  3. 3.

    f3(T[i][s][c],P[ji,h+c])=T[i][s][c]P[ji,h+c]f_{3}(T[i][s][c],P[j_{i,h}+c])=T[i][s][c]\neq P[j_{i,h}+c], where c[1,ki]c\in[1,k_{i}].

These will be the oracle functions used by three nested Grover’s searches G1G_{1}, G2G_{2}, and G3G_{3}, respectively, going from the outer level to the inner one.

4 Quantum Algorithm

The quantum algorithm simulates the parallel one by replacing the threads with a superposition. We recall that here we assume that ki<mk_{i}<m for every 1in1\leq i\leq n, and we show how to drop this assumption in Section 6. In our algorithm, we will use quantum registers ID, activei\texttt{active}_{i}, matchi\texttt{match}_{i}, Ki\texttt{K}_{i}, exti\texttt{ext}_{i}, suffmi\texttt{suffm}_{i}, prefmi\texttt{prefm}_{i}, where subscript ii refers to a generic ii-th instance among the nn copies of a certain register. We use these registers according to the following logic:

  • |hID\ket{h}_{\texttt{ID}} is such that 0hm10\leq h\leq m-1, serves as a substate identifier;

  • |ji,hprefix\ket{j_{i,h}}_{\texttt{prefix}} is such that 1ji,hm1\leq j_{i,h}\leq m, identifying which prefix of PP is managed by substate hh in the current iteration;

  • |kiKi\ket{k_{i}}_{\texttt{K}_{i}} stores the width kik_{i} of segment T[i]T[i];

  • |ai,hactivei=|1\ket{a_{i,h}}_{\texttt{active}_{i}}=\ket{1} if P[1..ji,h]P[1..j_{i,h}] matches a suffix of a string in T[1]T[i1]T[1]\cdots T[i-1], ai,h=0a_{i,h}=0 otherwise;

  • |mi,hmatchi=|1\ket{m_{i,h}}_{\texttt{match}_{i}}=\ket{1} if at least one full match for PP was found in GD string T[1]T[2]T[i1]T[1]T[2]\cdots T[i-1], mi,h=0m_{i,h}=0 otherwise;

  • |ext(ji,h,i,ki)exti=|1\ket{ext(j_{i,h},i,k_{i})}_{\texttt{ext}_{i}}=\ket{1} if substring P[ji,h+1..j+ki]T[i]P[j_{i,h}+1..j+k_{i}]\in T[i] (extension), ext(ji,h,i,ki)=0ext(j_{i,h},i,k_{i})=0 otherwise;

  • |sm(ji,h,i,ki)suffmi=|1\ket{sm(j_{i,h},i,k_{i})}_{\texttt{suffm}_{i}}=\ket{1} if suffix P[ji,h..m]P[j_{i,h}..m] is a prefix of a string in T[i]T[i] (suffix match), sm(ji,h,i,ki)=0sm(j_{i,h},i,k_{i})=0 otherwise;

  • |pm(ji,h,i,ki)prefmi=|1\ket{pm(j_{i,h},i,k_{i})}_{\texttt{prefm}_{i}}=\ket{1} if prefix P[1..ji,h+kim]P[1..j_{i,h}+k_{i}-m] is a suffix of a string in T[i]T[i] (prefix match), pm(ji,h,i,ki)=0pm(j_{i,h},i,k_{i})=0 otherwise.

In addition to these registers, we also assume to use all auxiliary qubits necessary to compute functions that can be implemented with a classical circuit.

At the beginning, we apply Hadamard gates on register ID to set up the balanced superposition

1mh=0m1|hID|00.\frac{1}{\sqrt{m}}\sum_{h=0}^{m-1}\ket{h}_{\texttt{ID}}\ket{0\cdots 0}.

Then, we perform a Grover’s search with input register |hID\ket{h}_{\texttt{ID}}, using the other registers to compute the oracle function, which in turn is implemented by two more levels of nested Grover’s searches. Let G1G_{1}, G2G_{2}, and G3G_{3} be the three unitary operators implementing these Grover’s searches. We now explain how to construct each one of them, starting from the most nested G3G_{3} to the least nested G1G_{1}.

Matching a string in a segment

Operator G3G_{3} is a Grover’s search that checks whether two given strings AA and BB of the same length ll are equal by looking for a single-character mismatch. The oracle is the Boolean function f3(c,A,B)=A[c+1]B[c+1]f_{3}(c,A,B)=A[c+1]\neq B[c+1], c[0,l+1]c\in[0,l+1], which can be implemented with a classical circuit. Thus, G3G_{3} performs the transformation

G3|ψstring=G3(1lc=0l1|c|A|B)=c=0l1αi|c|A|B=|ψstring.G_{3}\ket{\psi_{\text{string}}}=G_{3}\left(\frac{1}{\sqrt{l}}\sum_{c=0}^{l-1}\ket{c}\ket{A}\ket{B}\right)=\sum_{c=0}^{l-1}\alpha_{i}\ket{c}\ket{A}\ket{B}=\ket{\psi^{\prime}_{\text{string}}}.

Theorem 2 guarantees that, if |cf3=0c|ki|1,f3(c)=1|c\ket{c_{f_{3}}}=\sum_{0\leq c\leq|k_{i}|-1,\,f_{3}(c)=1}\ket{c} are those states for which f3f_{3} evaluates to 11, then |cf3|ψstring|2>2/3|\braket{c_{f_{3}}|\psi^{\prime}_{\text{string}}}|^{2}>2/3. Notice that |A|B\ket{A}\ket{B} is information present in memory that does not depend on cc, and accessing the single characters of AA and BB can be done employing QRAM queries.

Operator G2G_{2} is a Grover’s search that allow us to find a match for a string AA of into a segment T[i]T[i]. The oracle is the Boolean function f2(s,A)f_{2}(s,A), which returns 11 if string AA equals the ss-th string of T[i]T[i], and which we implement through G3G_{3}. Notice that, as done in previous works [22], G3G_{3} detects mismatches, so we will set f2(s,A)=0f_{2}(s,A)=0 whenever f3(c,A,B)=1f_{3}(c,A,B)=1 for some cc, otherwise we set f2(s,A)=1f_{2}(s,A)=1. We hence have that operator G2G_{2} performs the transformation

G2|ψsegment=G2(1|T[i]|s=0|T[i]|1|s|A)=s=0|T[i]|1αi|s|A=|ψsegment.G_{2}\ket{\psi_{\text{segment}}}=G_{2}\left(\frac{1}{\sqrt{|T[i]|}}\sum_{s=0}^{|T[i]|-1}\ket{s}\ket{A}\right)=\sum_{s=0}^{|T[i]|-1}\alpha_{i}\ket{s}\ket{A}=\ket{\psi^{\prime}_{\text{segment}}}.

Again, Theorem 2 guarantees that, if |sf2=0s|T[i]|1,f2(s)=1|s\ket{s_{f_{2}}}=\sum_{0\leq s\leq|T[i]|-1,\,f_{2}(s)=1}\ket{s} are those states for which f2f_{2} evaluates to 11, then |sf2|ψsegment|2>2/3|\braket{s_{f_{2}}|\psi^{\prime}_{\text{segment}}}|^{2}>2/3. As before, the characters of |A\ket{A} can be retrieved with QRAM queries.

For-loop computing f1f_{1}

The outermost Grover’s search, realized by operator G1G_{1}, solves the problem of finding a match for pattern string PP in GD string TT. The oracle is the Boolean function f1(h,P,T)f_{1}(h,P,T), which returns 11 if and only if PP has a match starting from some column h+rmh+r\cdot m in TT, for some integer rr such that mr<Wm\cdot r<W. Implementing this oracle function encapsulate the main logic of our algorithm. Notice that f1(0,P,T)f1(m1,P,T)=1f_{1}(0,P,T)\lor\cdots\lor f_{1}(m-1,P,T)=1 if and only if there is at least one match for PP in TT.

Let us now see how to compute f1f_{1}. Starting from a balanced superposition of hh “quantum threads”, the first step is to initialize register prefix by copying the values from register ID with CNOT gates

|ψ0=\displaystyle\ket{\psi_{0}}= 1mh=0m1|hID|0prefix|00|P|T\displaystyle\frac{1}{\sqrt{m}}\sum_{h=0}^{m-1}\ket{h}_{\texttt{ID}}\ket{0}_{\texttt{prefix}}\ket{0\cdots 0}\ket{P}\ket{T}\rightarrow
1mh=0m1|hID|hprefix|00|P|T.\displaystyle\frac{1}{\sqrt{m}}\sum_{h=0}^{m-1}\ket{h}_{\texttt{ID}}\ket{h}_{\texttt{prefix}}\ket{0\cdots 0}\ket{P}\ket{T}.

Then, we scan GD string TT from left to right, segment by segment, in a for-loop of nn iterations. To see how to perform one generic iteration ii, assume that right before that iteration the system is in state

|ψi=1mh=0m1|hID|ϕh\ket{\psi_{i}}=\frac{1}{\sqrt{m}}\sum_{h=0}^{m-1}\ket{h}_{\texttt{ID}}\ket{\phi_{h}}

where

|ϕh=|ji,hprefix|ai,hactivei|mi,hmatchi|kiKi|0exti|0suffmi|0prefmi\ket{\phi_{h}}=\ket{j_{i,h}}_{\texttt{prefix}}\ket{a_{i,h}}_{\texttt{active}_{i}}\ket{m_{i,h}}_{\texttt{match}_{i}}\ket{k_{i}}_{\texttt{K}_{i}}\ket{0}_{\texttt{ext}_{i}}\ket{0}_{\texttt{suffm}_{i}}\ket{0}_{\texttt{prefm}_{i}}

such that the following holds: index ji,h[1,m]j_{i,h}\in[1,m] is a position in PP, ai,h=1a_{i,h}=1 if and only if P[1..ji,h]P[1..j_{i,h}] matches a suffix of a string in T[1]T[i1]T[1]\cdots T[i-1], and mi,h=1m_{i,h}=1 if and only if PP has a match in T[1]T[i1]T[1]\cdots T[i-1] starting at column h+mrh+m\cdot r for some integer rr such that mr<Wm\cdot r<W. We now compute values ext(ji,h,i,ki)ext(j_{i,h},i,k_{i}), sm(ji,h,i,ki)sm(j_{i,h},i,k_{i}) and pm(ji,h,i,ki)pm(j_{i,h},i,k_{i}) using nested Grover’s searches G2G_{2} and G3G_{3}. We give the details of only the computation of ext(ji,h,i,ki)ext(j_{i,h},i,k_{i}), and sketch the computation of sm(ji,h,i,ki)sm(j_{i,h},i,k_{i}) and pm(ji,h,i,ki)pm(j_{i,h},i,k_{i}), as they are very similar. Value ext(ji,h,i,ki)=1ext(j_{i,h},i,k_{i})=1 if and only if P[ji,h..ji,h+ki]T[i]P[j_{i,h}..j_{i,h}+k_{i}]\in T[i]. To compute it, we run G2G_{2} over string P[ji,h..ji,h+ki]P[j_{i,h}..j_{i,h}+k_{i}] and segment T[i]T[i]. Notice that this is done in superposition, and every “quantum thread” checks a different substring of PP against the same T[i]T[i].

After computing ext(ji,h,i,ki)ext(j_{i,h},i,k_{i}), values sm(ji,h,i,ki)sm(j_{i,h},i,k_{i}) and pm(ji,h,i,ki)pm(j_{i,h},i,k_{i}) can be computed using the same strategy. The main difference is that, for sm(ji,h,i,ki)sm(j_{i,h},i,k_{i}), Grover’s search G2G_{2} will have to span the prefixes of the strings in T[i]T[i] of length mji,h+1m-j_{i,h}+1 and compare them against P[ji,h..m]P[j_{i,h}..m], while for pm(ji,h,i,ki)pm(j_{i,h},i,k_{i}) operator G2G_{2} has to act on suffixes of length ji,hj_{i,h} and compare them against P[1..ji,h]P[1..j_{i,h}].

At this point, the system is in state

1mh=0m1(|hID|ji,hprefix|ai,hactivei|mi,hmatchi|kiKi|ext(ji,h,ki)exti|sm(ji,h,ki)suffmi|pm(ji,h,ki)prefmi)\frac{1}{\sqrt{m}}\sum_{h=0}^{m-1}\left(\begin{aligned} &\ket{h}_{\texttt{ID}}\ket{j_{i,h}}_{\texttt{prefix}}\ket{a_{i,h}}_{\texttt{active}_{i}}\ket{m_{i,h}}_{\texttt{match}_{i}}\ket{k_{i}}_{\texttt{K}_{i}}\otimes\\ &\ket{ext(j_{i,h},k_{i})}_{\texttt{ext}_{i}}\ket{sm(j_{i,h},k_{i})}_{\texttt{suffm}_{i}}\ket{pm(j_{i,h},k_{i})}_{\texttt{prefm}_{i}}\end{aligned}\right)

and we have to update registers pmi+1,hpm_{i+1,h}, ai+1,ha_{i+1,h} and mi+1,hm_{i+1,h}. These are computed by classical computation performed in superposition. We set

prefixi+1,h=prefixi,h+ki+1modm.\texttt{prefix}_{i+1,h}=\texttt{prefix}_{i,h}+k_{i+1}\,mod\,m.

The updates for activei+1,h\texttt{active}_{i+1,h} and mi+1,hm_{i+1,h} are formally explained in Subroutine 1, but intuitively they go as follows. First we check whether ji,h+ki<mj_{i,h}+k_{i}<m. If yes, then the pattern spans the entire segment T[i]T[i], and we have to check if we can extend a match, in the case where we had an active prefix (ai,h=1a_{i,h}=1). If not, then the pattern ends in segment T[i]T[i], and thus we have to check if we got a full match (updating matchi+1,h=1\texttt{match}_{i+1,h}=1), and if a new match can start in this segment (updating ai+1,h=1a_{i+1,h}=1). Then, we make the update ji,hji,h+kij_{i,h}\leftarrow j_{i,h}+k_{i}, so that register prefix points to the next segment to process. We point out that using new registers at each iteration is needed since quantum computing must be reversible.

if ji,h+ki<mj_{i,h}+k_{i}<m then
 ai+1,hai,hext(ji,h,i,ki)a_{i+1,h}\leftarrow a_{i,h}\land ext(j_{i,h},i,k_{i});
 
else
 // ji,h+kimj_{i,h}+k_{i}\geq m
 ai+1,hpm(ji,h,i,ki)a_{i+1,h}\leftarrow pm(j_{i,h},i,k_{i});
 mi+1,hmi,h(sm(ji,h,i,ki)ai,h)m_{i+1,h}\leftarrow m_{i,h}\lor(sm(j_{i,h},i,k_{i})\land a_{i,h});
 
end if
Subroutine 1 Register updates for one iteration of the computation of oracle function f1f_{1}.

Right after iteration ii, we get the following state, which is the starting point for the next iteration:

|ψi+1=1mh=0m1(|hID|ji,h+kiprefix|ai+1,hactivei+1|mi+1,hmatchi+1|ki+1Ki+1|0exti+1|0suffmi+1|0prefmi+1)\ket{\psi_{i+1}}=\frac{1}{\sqrt{m}}\sum_{h=0}^{m-1}\left(\begin{aligned} &\ket{h}_{\texttt{ID}}\ket{j_{i,h}+k_{i}}_{\texttt{prefix}}\ket{a_{i+1,h}}_{\texttt{active}_{i+1}}\ket{m_{i+1,h}}_{\texttt{match}_{i+1}}\otimes\\ &\ket{k_{i+1}}_{\texttt{K}_{i+1}}\ket{0}_{\texttt{ext}_{i+1}}\ket{0}_{\texttt{suffm}_{i+1}}\ket{0}_{\texttt{prefm}_{i+1}}\end{aligned}\right)

After the last iteration of the for-loop, we have register match storing superposition h=0m1|mn,hmatchn\sum_{h=0}^{m-1}\ket{m_{n,h}}_{\texttt{match}_{n}}, where mn,h=1m_{n,h}=1 if at any iteration quantum thread hh found a match. Thus, applying a ZZ gate on this register will flip the phase and mark the elements for which we want to amplify the amplitude. This concludes the computation of f1f_{1}.

Finding a match for PP in TT

Now that we know how to compute f1f_{1}, we can use it as the oracle function. Thus, operator G1G_{1} is a Grover’s search that allow us to find a match for a string PP into a GD string TT. The oracle is the Boolean function f1(h,P,T)f_{1}(h,P,T), and thus G1G_{1} applies the transformation

G1|ψthread=G1(1ms=0m1|hID|P|T)=s=0m1αi|hID|P|T=|ψthread.G_{1}\ket{\psi_{\text{thread}}}=G_{1}\left(\frac{1}{\sqrt{m}}\sum_{s=0}^{m-1}\ket{h}_{\texttt{ID}}\ket{P}\ket{T}\right)=\sum_{s=0}^{m-1}\alpha_{i}\ket{h}_{\texttt{ID}}\ket{P}\ket{T}=\ket{\psi^{\prime}_{\text{thread}}}.

where, if |hf1=0hm1,f1(h,P,T)=1|h\ket{h_{f_{1}}}=\sum_{0\leq h\leq m-1,\,f_{1}(h,P,T)=1}\ket{h} are those states for which f1f_{1} evaluates to 11, then |hf1|ψthread|2>2/3|\braket{h_{f_{1}}|\psi^{\prime}_{\text{thread}}}|^{2}>2/3. Therefore, measuring register ID returns the index of a thread that detected a match with probability greater than 2/32/3, or a random thread if there was no match. This probability can be boosted arbitrarily, and one more evaluation of oracle function f1f_{1} can tell whether the result indicates the existence of a match or not.

5 Analysis

Let f1f_{1}, f2f_{2} and f3f_{3} be respectively the oracle functions of the three nested Grover’s searches, from outermost to innermost. We recall that

  • f1(h)=1f_{1}(h)=1 if and only if PP has a match starting from some column h+rmh+r\cdot m in TT, for some integer rr;

  • f2(h,i,s)=1f_{2}(h,i,s)=1 if and only if T[i][s+1]=P[ji,h+1..j+ki]T[i][s+1]=P[j_{i,h}+1..j+k_{i}], for s[0,|T[i]|]s\in[0,|T[i]|];

  • f3(h,i,s,c)=1f_{3}(h,i,s,c)=1 if and only if T[i][s+1][c+1]P[ji,h+c+1]T[i][s+1][c+1]\neq P[j_{i,h}+c+1].

Given that function f3f_{3} can be computed in constant time with a classical circuit, a standard application of Grover’s search on input |ψstring\ket{\psi_{\text{string}}} implies the following lemma.

Let ji,hj_{i,h}, ai,ha_{i,h} and mi,hm_{i,h} be the values stored in superposition in registers prefix, active and match for state h,s,cαh,s,c|ϕh|s|c\sum_{h,s,c}\alpha_{h,s,c}\ket{\phi_{h}}\ket{s}\ket{c}, where the summation goes over also ss and cc because G2G_{2} and G3G_{3} are not perfect oracles, and we can have spurious states with small amplitudes. We now consider only those states αh,s¯,c¯|ϕh|s|c\alpha_{h,\bar{s},\bar{c}}\ket{\phi_{h}}\ket{s}\ket{c} of maximal amplitude, namely such that |αh,s¯,c¯|=maxs,c|αh,s,c||\alpha_{h,\bar{s},\bar{c}}|=\max_{s,c}|\alpha_{h,s,c}|.

Lemma 3.

The for loop of our quantum algorithm maintains the following invariant right before every iteration ii:

Invariant: for every h[0,m1]h\in[0,m-1] it holds that:

  • ji,h=t=1i1ktj_{i,h}=\sum_{t=1}^{i-1}k_{t};

  • ji,h+1=ji,h+1j_{i,h+1}=j_{i,h}+1, where addition is performed modmmod\,m;

  • ai,h=1a_{i,h}=1 if and only if P[1..ji,h1]P[1..j_{i,h}-1] matches a suffix of T[1]T[i1]T[1]\cdots T[i-1];

  • mi,h=1m_{i,h}=1 if and only if PP has a match in T[1]T[i1]T[1]\cdots T[i-1].

Proof.

To prove the correctness of the updates, we proceed by induction on the iteration number ii. Right before iteration ii, the algorithm maintains the following invariant.

Base case, i=1i=1. When the system is initialized with all threads active we have ji,h=hj_{i,h}=h, a1,h=0a_{1,h}=0, m1,h=0m_{1,h}=0 for every hh, and the invariant holds trivially as no text has been processed and no partial matches exist beyond the empty prefix.

Inductive case, i>1i>1. We assume the invariant holds before iteration ii, and we prove that it still holds after iteration ii, right before iteration i+1i+1. We show that the values for any thread hh are updated correctly. Since we compute the new values of active and match according to Subroutine 1, we have two cases: (i) ji,h+ki<mj_{i,h}+k_{i}<m, (ii) ji,h+kimj_{i,h}+k_{i}\geq m. In case (i), if ai,h=0a_{i,h}=0 then by inductive hypothesis prefix P[1..ji,h1]P[1..j_{i,h}-1] is not matching, and we correctly set ai+1,h=0a_{i+1,h}=0. Otherwise, ai,h=1a_{i,h}=1 and by inductive hypothesis the prefix P[1..ji,h1]P[1..j_{i,h}-1] has an active match. If that occurrence extends into T[i]T[i], there must exists a string sT[i]s\in T[i] matching P[ji,h..ji,h+ki]P[j_{i,h}..j_{i,h}+k_{i}]. Whether such a string exists or not is determined by G2G_{2}, whose result is the value ext(j,i,ki)ext(j,i,k_{i}), and in this case we properly set ai+1,h=ext(j,i,ki)a_{i+1,h}=ext(j,i,k_{i}). In case (ii), an occurrence of PP might end in T[i]T[i], a new one could start, and the record of an old one could carry over. Whether a string sT[i]s\in T[i] has a prefix matching P[ji,h..m]P[j_{i,h}..m] or not is found with another application of G2G_{2}, which sets the value sm(ji,h,i,ki)sm(j_{i,h},i,k_{i}). Then, mi+1,hm_{i+1,h} is set to if and only if both sm(ji,h,i,ki)=1sm(j_{i,h},i,k_{i})=1 and ai,h=1a_{i,h}=1, that is by inductive hypothesis there is an active match for P[1..ji,h1]P[1..j_{i,h}-1]. To set ai+1,ha_{i+1,h}, it suffices to detect if P[1..kim+ji,h]P[1..k_{i}-m+j_{i,h}] matches a suffix of a string in T[i]T[i], which is done with the third application of G2G_{2} yielding pm(ji,h,i,ki)pm(j_{i,h},i,k_{i}). If it was the case that mhi=1m_{h_{i}}=1, by inductive hypothesis we already found a match at a previous iteration, thus we correctly set mi+1,h=1m_{i+1,h}=1. Lastly, we always increment ji,hj_{i,h} by kik_{i} at the end of the iteration, and since by inductive hypothesis ji,h=t=1i1ktj_{i,h}=\sum_{t=1}^{i-1}k_{t}, we have jh+1=ki+t=1i1kt=t=1iktj_{h+1}=k_{i}+\sum_{t=1}^{i-1}k_{t}=\sum_{t=1}^{i}k_{t}. From this also follows that ji+1,h+1=ji+1,h+1j_{i+1,h+1}=j_{i+1,h}+1. ∎

Lemma 4.

Let GD string TT have nn segments T[i]T[i] each of size kik_{i}. The for-loop of our quantum algorithm correctly computes oracle function f1f_{1} in time O~(i=1nT[i]ki)\tilde{O}(\sum_{i=1}^{n}\sqrt{T[i]\cdot k_{i}}) with constant probability of success p1>2/3p_{1}>2/3.

Proof.

Using Lemma 3, we know that after iteration nn (technically right before a virtual iteration n+1n+1), we have mn,h=1m_{n,h}=1 if and only if thread hh found at least one match for PP in T[1]T[n]=TT[1]\cdots T[n]=T, which guarantees the correctness of the computation of f1f_{1}. Thus, the correctness of the entire algorithm and the success probability of p1>2/3p_{1}>2/3 follow from Lemma 3, Theorem 2 applied to G2G_{2} and G3G_{3}, and the following observation. At any iteration ii of the for-loop, for every column in T[i]T[i] there exists a thread hh that tries to start a match from that column. To see this, recall that ji,hj_{i,h} is a position in PP and that a thread tries to match prefix P[1..ji,hm+ki]P[1..j_{i,h}-m+k_{i}] as a suffix of a string in T[i]T[i] when ji,h+kimj_{i,h}+k_{i}\geq m. Thus, ji,h+kij_{i,h}+k_{i} assumes all values between 1+ki1+k_{i} to m+kim+k_{i} as a function of hh, which means there is a thread for every column.

At iteration ii, G3G_{3} is applied to strings that are not longer than kik_{i}, thus its complexity is O~(ki)\tilde{O}\left(\sqrt{k_{i}}\right). The most expensive computation of G2G_{2} is the one for ext(ji,h,i,ki)ext(j_{i,h},i,k_{i}), as it involves the longest strings. This takes time O~(|T[i]|ki)\tilde{O}\left(\sqrt{|T[i]|\cdot k_{i}}\right), as there are |T[i]||T[i]| strings in a segment and G3G_{3} is called as oracle. This is then the complexity of processing one segment. Since we process nn segments sequentially, we have O~(i=1nT[i]ki)\tilde{O}(\sum_{i=1}^{n}\sqrt{T[i]\cdot k_{i}}). ∎

Our main result Theorem 1 states that SMGD on a pattern string PP of length mm and a GD string of nn segments and size NN can be solved in time O~(mnN)\tilde{O}(\sqrt{mnN}) by a quantum algorithm with high probability. We are now ready to formally prove this result.

Proof of Theorem 1.

From Lemma 4, if an occurrence of PP exists in TT, there exists at least one thread hh such that mn,h=1m_{n,h}=1. The algorithm applies Grover’s search G1G_{1} to the equally balanced superposition h=0m|h|0|0\sum_{h=0}^{m}\ket{h}\ket{0}\cdot\ket{0}, and from the properties of Grover’s search [14] follows that measuring the system after the appropriate number of iterations yields a state |h\ket{h} such that f1(h)=1f_{1}(h)=1 with probability p>2/3p>2/3 if at least one match exists. If no match exists, the oracle never marks any state and the measurement will return a random thread index. We can verify whether f1(h)=1f_{1}(h)=1 or f1(h)=0f_{1}(h)=0 by running one more evaluation of the oracle function.

The computation of G1G_{1} requires O(m)O(\sqrt{m}) queries to oracle function f1f_{1}. Combining this with Lemma 4, we obtain a total complexity of

O~(mi=1nT[i]ki).\tilde{O}\left(\sqrt{m}\sum_{i=1}^{n}\sqrt{T[i]\cdot k_{i}}\right).

Using the Cauchy–Schwarz inequality (details in Appendix A), this can be shown to be bounded by O~(mnN)\tilde{O}\left(\sqrt{mnN}\right). ∎

For what concerns space complexity, we need O(logm)O(\log m) qubits for the register representing thread IDs, and O(logN)O(\log N) for the registers introduced at each iteration, as values kik_{i} could be order of O(N)O(N) in the worst case. Since we need to introduce nn of these registers, one per iteration, the total space complexity is O(logm+nlogN)O(\log m+n\log N) qubits.

6 Dropping assumptions

So far, we assumed that ki<mk_{i}<m for every 1in1\leq i\leq n. Let us now drop this assumption. We can still find a match for PP in TT without losing on the complexity. To this end, let us first design a quantum algorithm that checks whether PP has a match as a substring of a string in TT. We achieve this with two nested Grover’s searches, the outer one ranging over all NN characters in TT, and the inner one ranging over all mm pattern positions in PP. The inner Grover’s search uses an oracle function that detects two things: single characters mismatches, and whether the character that we are checking is the last one in a segment string when we are not on the last position of the pattern. The outer Grover’s search uses the inner one as oracle function. Thus, this takes O~(mN)\tilde{O}\left(\sqrt{mN}\right) in total, which is less than the overall complexity O~(mnN)\tilde{O}\left(\sqrt{mnN}\right).

If the above preprocessing procedure found no matches, we can continue with our main algorithm assuming that PP does not match as a substring of a string in TT. However, it can still be the case that ki>mk_{i}>m for some ii, requiring us to make a small modification to the algorithm. In the main for loop, whenever we encounter a segment T[i]T[i] such that ki>mk_{i}>m, we do not compute ext(ji,h,i,ki)ext(j_{i,h},i,k_{i}), but only sm(ji,h,i,ki)sm(j_{i,h},i,k_{i}) and pm(ji,h,i,ki)pm(j_{i,h},i,k_{i}). Now it is no longer true what we showed in the proof of Lemma 4, that is not all columns will have a quantum thread that tries to start a match. However, it is easy to see that the columns that we do not cover were already checked by the preprocessing procedure explained above.

References

  • [1] S. Akmal and C. Jin (2023) Near-optimal quantum algorithms for string problems. Algorithmica 85 (8), pp. 2260–2317. External Links: Link, Document Cited by: §1.
  • [2] M. Alzamel, L. A. K. Ayad, G. Bernardini, R. Grossi, C. S. Iliopoulos, N. Pisanti, S. P. Pissis, and G. Rosone (2018) Degenerate string comparison and applications. In 18th International Workshop on Algorithms in Bioinformatics (WABI), LIPIcs, Vol. 113, pp. 21:1–21:14. External Links: Document Cited by: §1.
  • [3] M. Alzamel, L. A. K. Ayad, G. Bernardini, R. Grossi, C. S. Iliopoulos, N. Pisanti, S. P. Pissis, and G. Rosone (2020) Comparing degenerate strings. Fundam. Informaticae 175 (1-4), pp. 41–58. External Links: Document Cited by: §1.
  • [4] R. Ascone, G. Bernardini, A. Conte, M. Equi, E. Gabory, R. Grossi, and N. Pisanti (2024) A unifying taxonomy of pattern matching in degenerate strings and founder graphs. In 24th International Workshop on Algorithms in Bioinformatics, WABI 2024, Royal Holloway, London, United Kingdom, September 2-4, 2024, S. P. Pissis and W. Sung (Eds.), LIPIcs, Vol. 312, pp. 14:1–14:21. External Links: Link, Document Cited by: §1.1, §1.2, §1.
  • [5] M. Boroujeni, S. Ehsani, M. Ghodsi, M. Hajiaghayi, and S. Seddighin (2021) Approximating edit distance in truly subquadratic time: quantum and mapreduce. J. ACM 68 (3), pp. 19:1–19:41. External Links: Link, Document Cited by: §1.
  • [6] G. Brassard, P. Høyer, M. Mosca, and A. Tapp (2002) Quantum amplitude amplification and estimation. In Quantum Computation and Information, Contemporary Mathematics, Vol. 305, pp. 53–74. External Links: ISBN 0-8218-2140-7, Document Cited by: §2.2, Theorem 2.
  • [7] H. Buhrman, S. Patro, and F. Speelman (2021) A framework of quantum strong exponential-time hypotheses. In 38th International Symposium on Theoretical Aspects of Computer Science, STACS 2021, Saarbrücken, Germany (Virtual Conference), March 16-19, 2021, M. Bläser and B. Monmege (Eds.), LIPIcs, Vol. 187, pp. 19:1–19:19. External Links: Link, Document Cited by: §1.2.
  • [8] P. Darbari, D. Gibney, and S. V. Thankachan (2022) Quantum time complexity and algorithms for pattern matching on labeled graphs. In String Processing and Information Retrieval - 29th International Symposium, SPIRE 2022, Concepción, Chile, November 8-10, 2022, Proceedings, Lecture Notes in Computer Science, Vol. 13617, pp. 303–314. External Links: Link, Document Cited by: §1.2, §1.
  • [9] M. Equi, A. M. de Griend, and V. Mäkinen (2023) From bit-parallelism to quantum string matching for labelled graphs. In 34th Annual Symposium on Combinatorial Pattern Matching, CPM 2023, Marne-la-Vallée, France, June 26-28, 2023, L. Bulteau and Z. Lipták (Eds.), LIPIcs, Vol. 259, pp. 9:1–9:20. External Links: Link, Document Cited by: §1.1, §1.2, §1.
  • [10] M. Equi, T. Norri, J. Alanko, B. Cazaux, A. I. Tomescu, and V. Mäkinen (2021) Algorithms and complexity on indexing elastic founder graphs. In 32nd International Symposium on Algorithms and Computation, ISAAC 2021, Fukuoka, Japan, December 6-8, 2021, H. Ahn and K. Sadakane (Eds.), LIPIcs, Vol. 212, pp. 20:1–20:18. External Links: Link, Document Cited by: §1.
  • [11] F. L. Gall and S. Seddighin (2023) Quantum meets fine-grained complexity: sublinear time quantum algorithms for string problems. Algorithmica 85 (5), pp. 1251–1286. External Links: Link, Document Cited by: §1.
  • [12] D. Gibney, C. Jin, T. Kociumaka, and S. V. Thankachan (2024) Near-optimal quantum algorithms for bounded edit distance and lempel-ziv factorization. In Proceedings of the 2024 ACM-SIAM Symposium on Discrete Algorithms, SODA 2024, Alexandria, VA, USA, January 7-10, 2024, D. P. Woodruff (Ed.), pp. 3302–3332. External Links: Link, Document Cited by: §1.
  • [13] R. Grossi, C. S. Iliopoulos, C. Liu, N. Pisanti, S. P. Pissis, A. Retha, G. Rosone, F. Vayani, and L. Versari (2017) On-line pattern matching on similar texts. In 28th Annual Symposium on Combinatorial Pattern Matching (CPM), LIPIcs, Vol. 78, pp. 9:1–9:14. External Links: Document Cited by: §1.
  • [14] L. K. Grover (1996) A fast quantum mechanical algorithm for database search. In Proceedings of the Twenty-Eighth Annual ACM Symposium on the Theory of Computing, Philadelphia, Pennsylvania, USA, May 22-24, 1996, pp. 212–219. External Links: Link, Document Cited by: §2.2, §5, Theorem 2.
  • [15] C. S. Iliopoulos, R. Kundu, and S. P. Pissis (2021) Efficient pattern matching in elastic-degenerate strings. Information and Computation 279, pp. 104616. External Links: Link, Document Cited by: §1.
  • [16] C. S. Iliopoulos, L. Mouchard, and M. S. Rahman (2008) A new approach to pattern matching in degenerate DNA/RNA sequences and distributed pattern matching. Math. Comput. Sci. 1 (4), pp. 557–569. External Links: Document Cited by: §1.
  • [17] C. Jin and J. Nogler (2024) Quantum speed-ups for string synchronizing sets, longest common substring, and k-mismatch matching. ACM Trans. Algorithms 20 (4), pp. 32:1–32:36. External Links: Link, Document Cited by: §1.
  • [18] K. Khadiev and D. Serov (2025) Quantum algorithm for the multiple string matching problem. In SOFSEM 2025: Theory and Practice of Computer Science: 50th International Conference on Current Trends in Theory and Practice of Computer Science, SOFSEM 2025, Bratislava, Slovak Republic, January 20–23, 2025, Proceedings, Part II, Berlin, Heidelberg, pp. 58–69. External Links: ISBN 978-3-031-82696-2, Link, Document Cited by: §1.
  • [19] D. E. Knuth, J. H. M. Jr., and V. R. Pratt (1977) Fast pattern matching in strings. SIAM J. Comput. 6 (2), pp. 323–350. External Links: Link, Document Cited by: §1.
  • [20] V. Mäkinen, B. Cazaux, M. Equi, T. Norri, and A. I. Tomescu (2020) Linear time construction of indexable founder block graphs. In 20th International Workshop on Algorithms in Bioinformatics (WABI), LIPIcs, Vol. 172, pp. 7:1–7:18. External Links: Document Cited by: §1.
  • [21] M. A. Nielsen and I. L. Chuang (2010) Quantum computation and quantum information: 10th anniversary edition. Cambridge University Press. External Links: Document Cited by: §2.2.
  • [22] H. Ramesh and V. Vinay (2003) String matching in O(n+m)O(\sqrt{n}+\sqrt{m}) quantum time. Journal of Discrete Algorithms 1 (1), pp. 103–110. Note: Combinatorial Algorithms External Links: ISSN 1570-8667, Document Cited by: §1, §4.
  • [23] N. Rizzo, M. Equi, T. Norri, and V. Mäkinen (2024) Elastic founder graphs improved and enhanced. Theor. Comput. Sci. 982, pp. 114269. External Links: Link, Document Cited by: §1.
  • [24] Q. Wang and M. Ying (2024) Quantum algorithm for lexicographically minimal string rotation. Theory Comput. Syst. 68 (1), pp. 29–74. External Links: Link, Document Cited by: §1.

Appendix A Complexity

Lemma 5.

Let N=i=1n|T[i]|kiN=\sum_{i=1}^{n}|T[i]|k_{i} be the total length of all strings constituting the GD string TT. The following inequality holds:

i=1n|T[i]|kinN\sum_{i=1}^{n}\sqrt{|T[i]|k_{i}}\leq\sqrt{nN}
Proof.

We apply the Cauchy-Schwarz inequality, which states that for any sequences of real numbers (a1,,an)(a_{1},\dots,a_{n}) and (b1,,bn)(b_{1},\dots,b_{n}),

(i=1naibi)2(i=1nai2)(i=1nbi2)\left(\sum_{i=1}^{n}a_{i}b_{i}\right)^{2}\leq\left(\sum_{i=1}^{n}a_{i}^{2}\right)\left(\sum_{i=1}^{n}b_{i}^{2}\right)
  • Let ai=1a_{i}=1 for all i=1,,ni=1,\dots,n.

  • Let bi=|T[i]|kib_{i}=\sqrt{|T[i]|k_{i}}.

Substituting these into the inequality we have,

(i=1n1|T[i]|ki)2(i=1n12)(i=1n(|T[i]|ki)2)\left(\sum_{i=1}^{n}1\cdot\sqrt{|T[i]|k_{i}}\right)^{2}\leq\left(\sum_{i=1}^{n}1^{2}\right)\left(\sum_{i=1}^{n}\left(\sqrt{|T[i]|k_{i}}\right)^{2}\right)

where

i=1n12=i=1n1=nandi=1n(|T[i]|ki)2=i=1n|T[i]|ki.\sum_{i=1}^{n}1^{2}=\sum_{i=1}^{n}1=n\quad\text{and}\quad\sum_{i=1}^{n}\left(\sqrt{|T[i]|k_{i}}\right)^{2}=\sum_{i=1}^{n}|T[i]|k_{i}.

By definition, i=1n|T[i]|ki\sum_{i=1}^{n}|T[i]|k_{i} is exactly NN, the total size of the GD string.

Therefore,

(i=1n|T[i]|ki)2nN\left(\sum_{i=1}^{n}\sqrt{|T[i]|k_{i}}\right)^{2}\leq n\cdot N

Taking the square root of both sides, we obtain,

i=1n|T[i]|kinN\sum_{i=1}^{n}\sqrt{|T[i]|k_{i}}\leq\sqrt{nN}

BETA