Bacterial glass transition
Abstract
Bacterial assemblies exhibit rich collective behaviors that control their biological functions, making them a relevant object of study from an active matter physics perspective. Dense bacterial suspensions self-organize into distinct physical phases with intriguing dynamical properties. Here, we study dense two-dimensional films of swimming bacteria using advanced imaging techniques and machine learning. By varying density, we uncover a bacterial glass transition, a direct active matter analogue of equilibrium glass transitions in colloidal and molecular fluids. The transition is marked by a dramatic slowdown of dynamics with minimal structural change. Strong dynamic heterogeneity emerges in space and time, leading to an anomalous violation of the Stokes-Einstein relation and a growing dynamic correlation length, universally observed across five bacterial strains. Our results establish that bacterial colonies exhibit glassy dynamics, but their living, active nature gives them unique properties, paving the way for new research regarding how non-equilibrium physics impacts biology.
In infectious settings, bacteria often transition from motile planktonic cells to surface-attached communities known as biofilms, that are highly resilient to antibiotics and immune responses [1]. This process involves complex regulatory processes—including mechanosensing, signaling, and matrix production [2, 3, 4]. Beyond these biochemical pathways, dense bacterial populations also behave as active physical systems: driven by cellular processes such as growth and motility, they exhibit collective dynamics that emerge from many-body interactions between the self-propelled cells. The formation and evolution of dense communities are therefore also shaped by physical mechanisms [5, 6, 7, 8], among which crowding plays a central role by altering cell motility and organization [9, 10]. At intermediate densities, hydrodynamic interactions among motile bacteria may give rise to active turbulence, producing chaotic flow patterns [11, 12, 13, 14]. As density increases further, these assemblies undergo a fluid-to-solid transition [15, 16, 17, 18, 19]. Here, our goal is to fully elucidate the consequences of crowding and to provide an in-depth experimental study of the nature of the dynamic slow-down and dynamic arrest in bacterial colonies.
Due to asynchronous division cycles, bacterial cells exhibit a broad size distribution, spanning from newly divided cells to those approaching division [20, 21]. This inherent variability prevents crystallization and long-range order, causing dense bacterial colonies to form amorphous solid structures at high densities. We refer to this process as a bacterial glass transition, by analogy with equilibrium colloidal and molecular glass transitions [22].
Active glass transitions have been observed in systems of self-driven particles, where dynamic arrest emerges in the absence of long-range order [23, 24]. A central question is whether active glasses exhibit behaviors comparable to their equilibrium counterparts, but addressing it is experimentally challenging. Such studies require precise control over experimental parameters such as particle density and motility, along with high-quality, high-resolution datasets capable of capturing the hallmarks of glass transitions that require space-time resolution over large length scales and time scales.
Experimental studies of glass transitions in synthetic active systems, such as phoretic colloids [25, 26] and robotic cell mimics [27], have revealed some glassy behaviors but are often constrained by small system sizes and limited dynamical properties. In contrast, a wider range of biological systems—including cell tissues, ant aggregates, and cytoplasmic components (see [28] for a review)—have been observed to exhibit some glassy characteristics, with bacterial systems among them [29, 30]. However, the complexity of biological systems makes experimental control challenging, and quantification remains difficult due to limitations in detecting and tracking individual components over multiple scales.
Here, we successfully overcome these long-standing challenges. Exploiting the ability of bacteria to form large monolayers on agar gels, we collected an unprecedented dataset spanning multiple orders of magnitude in both space and time. Using advanced imaging techniques combined with machine learning, we tracked thousands of individual cells over a broad range of densities, fully capturing the gradual transition to an amorphous bacterial glass. This comprehensive dataset not only enables us to rigorously characterize the overall slowdown in cell dynamics but also reveals its emerging complex fluctuations in space and time, testing the universality of our results by studying five different bacterial strains. Our comprehensive work offers a unique opportunity to analyze glassy dynamics far from equilibrium in a well-characterized and controllable active biological system.
Crowded and disordered bacterial monolayers
Monolayers naturally form at the edge of swarming colonies of Pseudomonas aeruginosa, see Fig. 1(A), a motile rod-shaped bacterium that alternates forward and backward motion (run-reverse). This movement is driven by its polar flagellum, that spins alternately in counterclockwise and clockwise directions. We developed an experimental setup to observe and analyze large monolayers within these colonies (see Methods for further details [31]). Unlike Bacillus subtilis, a bacterium known for its pronounced flocking behavior [32, 33], P. aeruginosa cells do not exhibit collective flocking, presumably due to the dispersion in their swimming speeds. While individual P. aeruginosa cells transiently align, activity and polydispersity prevent both long-range nematic and tetratic order [34] (fig. S1). Due to the asynchronous division cycle, cell lengths are widely distributed (fig. S2). This is a key factor in the emergence of a two-dimensional amorphous phase at high surface fractions, . Using Distnet2D, a state-of-the-art deep learning-based segmentation and tracking tool that leverages temporal information [35], we reconstructed the shape and dynamic trajectories of all cells within a broad field of view, following thousands of cells simultaneously over long times (Figs. 1(B, C) and fig. S3 for an illustration of the entire field of view). Having access to detailed positional and orientational data across a wide range of surface fractions for a large number of particles enables us to compile the robust dataset spanning multiple orders of magnitude in both space and time needed to study the transition to a bacterial glass phase.
Slowing down of orientational and translational dynamics
The bacterial monolayer did not exhibit strong structural change as the density increases (fig. S4). In contrast, a clear dynamical slowdown was evident in the experimental movies (Movies S1, S2 and S3). To quantify this, we computed time correlation functions characterizing orientational and translational motion of individual cells. For orientations, the correlation function was calculated by following the evolution of the angle between the body of cell at time and the horizontal axis:
| (1) |
where brackets indicate an average over . For translations, the persistence function was calculated by discretizing space into a lattice of boxes of linear size equal to the average cell length, and tracking the fraction of cells remaining in their initial box after a delay :
| (2) |
with as long as cell remains in the box it occupies at , and after that. Fig. 2(A, B) show both correlation functions for a range of surface fractions and demonstrate the gradual, but very pronounced, slowdown of dynamics as increases.
To quantify the observed slowdown, we extracted the respective relaxation times and from fitting the time decay of correlation functions to stretched exponential forms. The characteristic time for translation corresponds to the average time it takes bacterium to travel a distance equal to its body length, a metric analogous to the -relaxation time in glassy systems. Instead, quantifies the average time to reorient by an angle roughly equal to . The surface fraction dependence of both correlation times is shown in Fig. 2(C). The weak evolution for becomes much sharper when . As found for Brownian colloids [36], this behaviour can be well described by an exponential divergence
| (3) |
mathematically analogous to the Vogel-Fulcher-Tamman law used for molecular fluids [22]. In Eq. (3), describes the relaxation time in the dilute limit, plays the role of a glass fragility, and is the critical surface fraction where timescales diverge. We obtain very close values for both degrees of freedom, and . The raw data and for all strains are in fig. S5 and VFT fitting parameters in fig. S6. The strong similarity between timescales is further demonstrated in the parametric plot in Fig. 2(D), where a relation is obeyed across all timescales for all tested bacterial strains (best fit is ). A final indicator of dynamic arrest directly focusing on real space motion is the mean-squared displacement (MSD)
| (4) |
We followed its evolution with at fixed s: see fig. S7 for the raw data and Fig. 2(E) for a compilation of fits to Eq. (3). For P. aeruginosa, we get , again very close to and . Within statistical errors, these data confirm a simultaneous global arrest of all degrees of freedom for all strains, in sharp contrast with the conclusions of Ref. [29].
To understand the possible influence of single-cell motility on the glassy dynamics, we repeated our analysis for various mutants of P. aeruginosa (list in Table S1). While most of our results are for the wild type, which has a single polar flagellum enabling forward and backward swimming, we also examined mutants with a similar aspect ratio to the wild type (fig. S2 shows a comparison of cell size distributions): cheR1 swims unidirectionally (Movie S5), the multi-flagellated hyperswarmer mutant exhibits increased swimming speed, and the pilA mutant lacks type IV pili – appendages critical for cell-cell and cell-substrate interactions, as well as for cell twitching. For these mutants, glass transitions occurred at a comparable critical surface fraction, , see Fig. 2(F) and fig. S7. The more elongated hyperswarmer mutant, frik, with an average aspect ratio 44% greater than the wild type, showed a lower critical surface fraction ( 0.003, very close to 0.002) and a higher fragility (fig. S8 and Movie S4). Even for this more elongated cell, we do not observe the decoupling between orientational and translational glass transitions reported in some earlier studies of elongated colloids [37] and Escherichia coli bacteria [29]. Overall, these results show that the main features of the bacterial glass transition are not affected by details of single-cell motility, but its precise location is more sensitive to geometry than to motility.
Emergence of dynamic heterogeneity
Ensemble-averaged time correlation functions reveal a dramatic slowing down of the dynamics. For equilibrium fluids, this slowing down is accompanied by strong and specific fluctuations. These dynamic heterogeneities [38] physically imply the co-existence, at any moment, of fast and slow cell motion emerging from a broad distribution of dynamic behaviors. We analyzed the probability distribution of single bacteria displacements over different time delays, see Fig. 3(A). This van Hove distribution is defined as with the components of and the number of cells in the field of view. Distributions over a broad range of time delays and surface fractions reveal the existence of large-displacement tails extending much further than the corresponding Gaussian distribution. These near-exponential tails [39] reveal the existence of a population of cells moving significantly faster than the average population, and, more broadly, of a displacement mechanism that differs qualitatively from Fickian diffusion. A Gaussian distribution is only slowly recovered at very large times, when the system eventually displays homogeneous diffusive motion. We quantify deviations from Gaussianity using the non-Gaussian parameter (NGP) :
| (5) |
which vanishes, by definition, when is Gaussian. As shown in Fig. 3(B), exhibits a growing maximum at an intermediate time increasing rapidly with (see inset). The growing maximum reveals an increasingly broad distribution of particle displacements as the dynamics slows down [40]. In real space, the broad tails stem from a variety of individual trajectories, as illustrated in Fig. 3(C). All cells are trapped (or, caged) over long periods of time, and undergo large jumps at widely distributed times. As a result, over a given observation time, some cells perform many jumps while others barely move. The emergence of transient caging is also revealed by the MSD shown in Fig. 3(D). At low , a ballistic to diffusive evolution typical of persistent random walks is observed. Instead, a pronounced sub-diffusive plateau regime appears at large density, directly reflecting caging, perhaps the most robust signature of glassy dynamics.
Diffusion and anomalous Stokes-Einstein decoupling
The long-time limit of the MSD defines the diffusion constant, (see Methods for data analysis [31]). In simple fluids, the Stokes-Einstein relation states that is inversely proportional to the viscosity. In supercooled liquids, the viscosity is proportional to the relaxation times (here, and ), and the Stokes-Einstein relation becomes . Near the glass transition of thermal fluids, the strong heterogeneity of particle displacements leads to violations of the Stokes-Einstein relation [41], or, more generally, to a decoupling between various transport properties, often taking the form of a fractional relation, , with an empirical exponent. Our results for dense bacteria are in Fig. 3(E), showing a parametric plot of against for the five strains studied. Remarkably, a strong decoupling is observed for all systems, that can be described by a unique exponent, , independently of mutations and body geometry. In equilibrium systems, decoupling is explained by the fact that is dominated by the motion of fast particles while is controlled by the slow ones, thus leading to [41, 42]. Despite the presence of heterogeneity in our systems, we find instead a stronger variation of leading to . To our knowledge, no such value was observed in equilibrium systems. We hypothesize that this anomalous decoupling is specific to active glassy systems, where persistent self-propulsion may significantly affect the self-diffusion process. Further research, for instance using simulations of highly persistent particles [43], should elucidate this remarkable finding.
Growth of a dynamic correlation length
The emergence of broad distributions of particle displacements provides no information about the coherence and spatial organization of cell motion. Intuitively, crowding implies that a cell cannot move significantly if its neighbors do not simultaneously rearrange, like a person in a packed subway who can only move if others make space. Spatial correlations of the dynamics are a hallmark of glassy dynamics [38], and were also reported in simulations of active particles [44]. These correlations are much harder to measure experimentally, despite their fundamental relevance to reveal the underlying microscopic processes relevant to emerging glassiness.
We start with qualitative evidence of growing spatial correlations in Fig. 4(A), where we color-code the amplitude of particle displacements over a duration comparable to the relaxation time (Movies S6, S7, and S8). These maps reveal regions of high and low displacement, with a characteristic size that seems to increase with . Direct comparisons of translational and orientational heterogeneity maps reveal a strong correlation (fig. S9), demonstrating that fast moving bacteria also rotate fast (the corresponding statistical analysis is provided in Supplementary Text). Additionally, we gathered evidence (fig. S10) that the growing dynamic domains are uncorrelated with several structural features, such as local surface fraction, cell size, nematic order, and tetratic order. We also confirmed that flagellar activity is maintained when cells are caged (Movie S9). Together, these observations demonstrate that the emerging spatial dynamic correlations are controlled by the competition between crowding and activity, and represent a novel collective feature characterizing the dynamics of dense bacterial assemblies.
Following work on equilibrium systems [38], we quantify these growing correlations using multi-point correlation functions and susceptibilities. We first calculate the four-point dynamic susceptibility with where the local overlap (with ) is a convenient local indicator of motion [45]. As shown in Fig. 4(B), the four-point susceptibilities peak at a time scale that increases with surface fraction and essentially tracks the evolution of . Interestingly, the peak height also grows with , which directly reveals that the typical area of dynamically correlated regions increases as the bacterial glass transition is approached [46, 47].
To accurately measure the linear size of correlated domains, we calculated the spatial correlations between fluctuations of the local overlaps, , with , see Fig. 4(C). The measured four-point spatial correlation functions decay exponentially with distance, , which provides a determination of a characteristic correlation length . As shown in Fig. 4(D), increases modestly with surface fraction, as evidenced by the approximate linear relation . This relation, reported before for molecular fluids [48], confirms that dynamical heterogeneities grow as the system approaches a dynamically arrested glass state. A similar analysis for rotational motion (fig. S11) provides a comparable dynamical length scale, confirming further the strong coupling between position and orientation fluctuations.
Discussion and outlook
Our in-depth experimental analysis reveals emerging glassy behavior across bacterial monolayers, showing a general slowdown in dynamics and growing dynamic fluctuations in space and time as density approaches the bacterial glass transition that lead to arrested solid states. Leveraging high-resolution tracking of cell motion across several orders of magnitude in both space and time, we systematically quantify these effects with remarkable precision. Our main conclusion is that dense bacterial assemblies gradually solidify via a physical process exhibiting striking quantitative similarities with its counterpart in dense colloidal and molecular fluids, while also displaying unique behavior, including unusual violations of the Stokes-Einstein relation. Notably, we observe no decoupling between orientation and position dynamics across five bacterial strains, even for elongated mutants. This robust conclusion contrasts with recent studies on E. coli monolayers [29] and of colloidal ellipsoids [37], and is further supported by invoking frictional interactions between cells, as demonstrated recently in studies of elongated colloids with varying roughness [49].
We observed that variations in swimming behaviors – whether cells alternate directions or swim unidirectionally – have little to no impact on the critical surface fraction at which the glass transition occurs. Similarly, other motility features, such as multi-flagellation or the absence of type-IV pili, show no effect on glassy dynamics. These findings align well with numerical studies showing that the specifics of self-propulsion do not influence active glassy dynamics [50]. However, the elongated strain exhibits a lower critical surface fraction, emphasizing the importance of cell shape over motility details in setting the transition density.
From a biological perspective, our findings provide new insight into how dense bacterial populations reorganize under physical constraints. It is well established that P. aeruginosa transitions from a motile, planktonic state to a biofilm state upon surface adhesion, embedding cells within a protective extracellular matrix [51, 52]. This process is typically attributed to biochemical regulation, but our study shows that crowding alone can induce a dramatic reduction in motility, independently of any molecular commitment to the biofilm state. Rather than becoming entirely immobilized at high density, cells retain slow, correlated motion, which may support long-timescale structural remodeling, resource redistribution, or mechanical adaptation. These results suggest that crowding-induced slow-down is not merely a byproduct of biofilm formation, but may actively contribute to the transition by priming the population for matrix secretion, adhesion, and spatial patterning.
References
- [1] Hans-Curt Flemming, Jost Wingender, Ulrich Szewzyk, Peter Steinberg, Scott A Rice, and Staffan Kjelleberg. Biofilms: an emergent form of bacterial life. Nature Reviews Microbiology, 14(9):563–575, 2016.
- [2] Shanice S Webster, Gerard CL Wong, and George A O’Toole. The power of touch: type 4 pili, the von willebrand a domain, and surface sensing by pseudomonas aeruginosa. Journal of Bacteriology, 204(6):e00084–22, 2022.
- [3] Liyun Wang, Yu-Chern Wong, Joshua M Correira, Megan Wancura, Chris J Geiger, Shanice S Webster, Ahmed Touhami, Benjamin J Butler, George A O’Toole, Richard M Langford, et al. The accumulation and growth of pseudomonas aeruginosa on surfaces is modulated by surface mechanics via cyclic-di-gmp signaling. npj Biofilms and Microbiomes, 9(1):78, 2023.
- [4] Hans-Curt Flemming, Eric D van Hullebusch, Thomas R Neu, Per H Nielsen, Thomas Seviour, Paul Stoodley, Jost Wingender, and Stefan Wuertz. The biofilm matrix: multitasking in a shared space. Nature Reviews Microbiology, 21(2):70–86, 2023.
- [5] Avraham Be’er and Gil Ariel. A statistical physics view of swarming bacteria. Movement ecology, 7:1–17, 2019.
- [6] Berenike Maier. How physical interactions shape bacterial biofilms. Annual Review of Biophysics, 50(1):401–417, 2021.
- [7] Gerard CL Wong, Jyot D Antani, Pushkar P Lele, Jing Chen, Beiyan Nan, Marco J Kühn, Alexandre Persat, Jean-Louis Bru, Nina Molin Høyland-Kroghsbo, Albert Siryaporn, et al. Roadmap on emerging concepts in the physical biology of bacterial biofilms: from surface sensing to community formation. Physical biology, 18(5):051501, 2021.
- [8] Oskar Hallatschek, Sujit S Datta, Knut Drescher, Jörn Dunkel, Jens Elgeti, Bartek Waclaw, and Ned S Wingreen. Proliferating active matter. Nature Reviews Physics, pages 1–13, 2023.
- [9] Farzan Beroz, Jing Yan, Yigal Meir, Benedikt Sabass, Howard A Stone, Bonnie L Bassler, and Ned S Wingreen. Verticalization of bacterial biofilms. Nature physics, 14(9):954–960, 2018.
- [10] Oliver J Meacock, Amin Doostmohammadi, Kevin R Foster, Julia M Yeomans, and William M Durham. Bacteria solve the problem of crowding by moving slowly. Nature Physics, 17(2):205–210, 2021.
- [11] Christopher Dombrowski, Luis Cisneros, Sunita Chatkaew, Raymond E Goldstein, and John O Kessler. Self-concentration and large-scale coherence in bacterial dynamics. Physical review letters, 93(9):098103, 2004.
- [12] Jörn Dunkel, Sebastian Heidenreich, Knut Drescher, Henricus H Wensink, Markus Bär, and Raymond E Goldstein. Fluid dynamics of bacterial turbulence. Physical review letters, 110(22):228102, 2013.
- [13] Yi Peng, Zhengyang Liu, and Xiang Cheng. Imaging the emergence of bacterial turbulence: Phase diagram and transition kinetics. Science advances, 7(17):eabd1240, 2021.
- [14] Richard J Henshaw, Olivia G Martin, and Jeffrey S Guasto. Dynamic mode structure of active turbulence. Physical Review Fluids, 8(2):023101, 2023.
- [15] Dario Dell’Arciprete, Matthew L Blow, Aidan T Brown, Fred DC Farrell, Juho S Lintuvuori, Alexander F McVey, Davide Marenduzzo, and Wilson CK Poon. A growing bacterial colony in two dimensions as an active nematic. Nature communications, 9(1):4190, 2018.
- [16] Anupam Sengupta. Microbial active matter: A topological framework. Frontiers in Physics, 8:184, 2020.
- [17] Katherine Copenhagen, Ricard Alert, Ned S Wingreen, and Joshua W Shaevitz. Topological defects promote layer formation in myxococcus xanthus colonies. Nature Physics, 17(2):211–215, 2021.
- [18] Qiuting Zhang, Jian Li, Japinder Nijjer, Haoran Lu, Mrityunjay Kothari, Ricard Alert, Tal Cohen, and Jing Yan. Morphogenesis and cell ordering in confined bacterial biofilms. Proceedings of the National Academy of Sciences, 118(31):e2107107118, 2021.
- [19] Jayabrata Dhar, Anh LP Thai, Arkajyoti Ghoshal, Luca Giomi, and Anupam Sengupta. Self-regulation of phenotypic noise synchronizes emergent organization and active transport in confluent microbial environments. Nature Physics, 18(8):945–951, 2022.
- [20] Sattar Taheri-Araghi, Serena Bradde, John T Sauls, Norbert S Hill, Petra Anne Levin, Johan Paulsson, Massimo Vergassola, and Suckjoon Jun. Cell-size control and homeostasis in bacteria. Current biology, 25(3):385–391, 2015.
- [21] Maxime Deforet, Dave Van Ditmarsch, and Joao B Xavier. Cell-size homeostasis and the incremental rule in a bacterial pathogen. Biophysical journal, 109(3):521–528, 2015.
- [22] Ludovic Berthier and Giulio Biroli. Theoretical perspective on the glass transition and amorphous materials. Rev. Mod. Phys., 83:587–645, Jun 2011.
- [23] Liesbeth MC Janssen. Active glasses. Journal of Physics: Condensed Matter, 31(50):503002, 2019.
- [24] Ludovic Berthier, Elijah Flenner, and Grzegorz Szamel. Glassy dynamics in dense systems of active particles. The Journal of chemical physics, 150(20), 2019.
- [25] Natsuda Klongvessa, Félix Ginot, Christophe Ybert, Cécile Cottin-Bizonne, and Mathieu Leocmach. Active glass: Ergodicity breaking dramatically affects response to self-propulsion. Physical review letters, 123(24):248004, 2019.
- [26] Antina Ghosh, Sayan Maity, and Vijayakumar Chikkadi. Onset of slow dynamics in dense suspensions of active colloids. arXiv preprint arXiv:2406.17927, 2024.
- [27] Pragya Arora, Souvik Sadhukhan, Saroj Kumar Nandi, Dapeng Bi, AK Sood, and Rajesh Ganapathy. A shape-driven reentrant jamming transition in confluent monolayers of synthetic cell-mimics. Nature Communications, 15(1):5645, 2024.
- [28] Souvik Sadhukhan, Subhodeep Dey, Smarajit Karmakar, and Saroj Kumar Nandi. A perspective on active glassy dynamics in biological systems. The European Physical Journal Special Topics, pages 1–32, 2024.
- [29] Hisay Lama, Masahiro J Yamamoto, Yujiro Furuta, Takuro Shimaya, and Kazumasa A Takeuchi. Emergence of bacterial glass. PNAS Nexus, page pgae238, 2024.
- [30] Yujiro Sugino, Hiroyuki Ebata, Yoshiyuki Sowa, Atsushi Ikeda, and Daisuke Mizuno. Non-equilibrium fluidization of dense active suspension. arXiv preprint arXiv:2401.15658, 2024.
- [31] Materials and methods are available as supplementary material.
- [32] He-Peng Zhang, Avraham Be’er, E-L Florin, and Harry L Swinney. Collective motion and density fluctuations in bacterial colonies. Proceedings of the National Academy of Sciences, 107(31):13626–13630, 2010.
- [33] Hannah Jeckel, Eric Jelli, Raimo Hartmann, Praveen K Singh, Rachel Mok, Jan Frederik Totz, Lucia Vidakovic, Bruno Eckhardt, Jörn Dunkel, and Knut Drescher. Learning the space-time phase diagram of bacterial swarm expansion. Proceedings of the National Academy of Sciences, 116(5):1489–1494, 2019.
- [34] Miguel Gonzalez-Pinto, Florentino Borondo, Yuri Martínez-Ratón, and Enrique Velasco. Clustering in vibrated monolayers of granular rods. Soft Matter, 13(14):2571–2582, 2017.
- [35] Jean Ollion, Martin Maliet, Caroline Giuglaris, Élise Vacher, and Maxime Deforet. Distnet2d: Leveraging long-range temporal information for efficient segmentation and tracking. PRX Life, 2(2):023004, 2024.
- [36] Gary L Hunter and Eric R Weeks. The physics of the colloidal glass transition. Reports on progress in physics, 75(6):066501, 2012.
- [37] Zhongyu Zheng, Feng Wang, and Yilong Han. Glass transitions in quasi-two-dimensional suspensions of colloidal ellipsoids. Phys. Rev. Lett., 107:065702, Aug 2011.
- [38] Ludovic Berthier, Giulio Biroli, Jean-Philippe Bouchaud, Luca Cipelletti, and Wim van Saarloos. Dynamical heterogeneities in glasses, colloids, and granular media, volume 150. OUP Oxford, 2011.
- [39] Pinaki Chaudhuri, Ludovic Berthier, and Walter Kob. Universal nature of particle displacements close to glass and jamming transitions. Phys. Rev. Lett., 99:060604, Aug 2007.
- [40] Walter Kob, Claudio Donati, Steven J. Plimpton, Peter H. Poole, and Sharon C. Glotzer. Dynamical heterogeneities in a supercooled lennard-jones liquid. Phys. Rev. Lett., 79:2827–2830, Oct 1997.
- [41] Mark D Ediger. Spatially heterogeneous dynamics in supercooled liquids. Annual review of physical chemistry, 51(1):99–128, 2000.
- [42] YounJoon Jung, Juan P Garrahan, and David Chandler. Excitation lines and the breakdown of stokes-einstein relations in supercooled liquids. Physical Review E, 69(6):061205, 2004.
- [43] Yann-Edwin Keta, Robert L. Jack, and Ludovic Berthier. Disordered collective motion in dense assemblies of persistent particles. Phys. Rev. Lett., 129:048002, Jul 2022.
- [44] Kallol Paul, Anoop Mutneja, Saroj Kumar Nandi, and Smarajit Karmakar. Dynamical heterogeneity in active glasses is inherently different from its equilibrium behavior. Proceedings of the National Academy of Sciences, 120(34):e2217073120, 2023.
- [45] O. Dauchot, G. Marty, and G. Biroli. Dynamical heterogeneity close to the jamming transition in a sheared granular material. Phys. Rev. Lett., 95:265701, Dec 2005.
- [46] N Lačević and TB Schrøder. Spatially heterogeneous dynamics investigated via a time-dependent four-point density correlation function. The Journal of chemical physics, 119(14):7372–7387, 2003.
- [47] Cristina Toninelli, Matthieu Wyart, Ludovic Berthier, Giulio Biroli, and Jean-Philippe Bouchaud. Dynamical susceptibility of glass formers: Contrasting the predictions of theoretical scenarios. Phys. Rev. E, 71:041505, Apr 2005.
- [48] C. Dalle-Ferrier, C. Thibierge, C. Alba-Simionesco, L. Berthier, G. Biroli, J.-P. Bouchaud, F. Ladieu, D. L’Hôte, and G. Tarjus. Spatial correlations in the dynamics of glassforming liquids: Experimental determination of their temperature dependence. Phys. Rev. E, 76:041510, Oct 2007.
- [49] Jian Liang, Xuan Feng, Ning Zheng, Huaguang Wang, Ran Ni, and Zexin Zhang. Glass transition in monolayers of rough colloidal ellipsoids. Physical Review Letters, 134(3):038202, 2025.
- [50] Vincent E Debets and Liesbeth Janssen. Active glassy dynamics is unaffected by the microscopic details of self-propulsion. The Journal of Chemical Physics, 157(22), 2022.
- [51] Calvin K Lee, Jaime De Anda, Amy E Baker, Rachel R Bennett, Yun Luo, Ernest Y Lee, Joshua A Keefe, Joshua S Helali, Jie Ma, Kun Zhao, et al. Multigenerational memory and adaptive adhesion in early bacterial biofilm communities. Proceedings of the National Academy of Sciences, 115(17):4471–4476, 2018.
- [52] Jinyuan Yan, Maxime Deforet, Kerry E Boyle, Rayees Rahman, Raymond Liang, Chinweike Okegbe, Lars EP Dietrich, Weigang Qiu, and Joao B Xavier. Bow-tie signaling in c-di-gmp: Machine learning in a simple biochemical network. PLoS computational biology, 13(8):e1005677, 2017.
- [53] Jaime De Anda, Ernest Y Lee, Calvin K Lee, Rachel R Bennett, Xiang Ji, Soheil Soltani, Mark C Harrison, Amy E Baker, Yun Luo, Tom Chou, et al. High-speed “4d” computational microscopy of bacterial surface motility. Acs Nano, 11(9):9340–9351, 2017.
- [54] Maxime Deforet. Long-range alteration of the physical environment mediates cooperation between pseudomonas aeruginosa swarming colonies. Environmental Microbiology, 25(8):1451–1464, 2023.
- [55] Maxime Deforet, Dave Van Ditmarsch, Carlos Carmona-Fontaine, and Joao B Xavier. Hyperswarming adaptations in a bacterium improve collective motility without enhancing single cell motility. Soft matter, 10(14):2405–2413, 2014.
- [56] Dave Van Ditmarsch, Kerry E Boyle, Hassan Sakhtah, Jennifer E Oyler, Carey D Nadell, Éric Déziel, Lars EP Dietrich, and Joao B Xavier. Convergent evolution of hyperswarming leads to impaired biofilm formation in pathogenic bacteria. Cell reports, 4(4):697–708, 2013.
- [57] S. L. Kuchma, A. E. Ballok, J. H. Merritt, J. H. Hammond, W. Lu, J. D. Rabinowitz, and George A. O’Toole. Cyclic-di-gmp-mediated repression of swarming motility by pseudomonas aeruginosa: the pily1 gene and its impact on surface-associated behaviors. Journal of Bacteriology, 192(12):2950–2964, 2010.
- [58] Nicole T Liberati, Jonathan M Urbach, Sachiko Miyata, Daniel G Lee, Eliana Drenkard, Gang Wu, Jacinto Villanueva, Tao Wei, and Frederick M Ausubel. An ordered, nonredundant library of pseudomonas aeruginosa strain pa14 transposon insertion mutants. Proceedings of the national academy of sciences, 103(8):2833–2838, 2006.
- [59] Juliane Schmidt, Mathias Müsken, Tanja Becker, Zofia Magnowska, Daniela Bertinetti, Stefan Möller, Bastian Zimmermann, Friedrich W Herberg, Lothar Jänsch, and Susanne Häussler. The pseudomonas aeruginosa chemotaxis methyltransferase cher1 impacts on bacterial surface sampling. PloS one, 6(3):e18184, 2011.
Acknowledgments
The authors thank Lisa Sanchez for providing the PMQ30 plasmid, Susanne Häußler for the cheR1 strain, and Dominique Limoli for the pilA strain. They are also grateful to Elizabeth Warren for assistance with the mutation protocol. Additional thanks go to Jean Ollion for support with training Distnet2D, and to Pierre Illien for fruitful discussions.
Funding:
MD and MM acknowledge the support of the French Agence Nationale de la Recherche (ANR), under grant ANR-21-CE30-0025 (project X-BACAMAT). LB acknowledges the support of the French Agence Nationale de la Recherche (ANR), under grant ANR-20-CE30-0031 (project THEMA).
Author contributions: Conceptualization:
MM, LB, MD; Formal analysis: MM, MD; Funding Acquisition: LB, MD; Investigation: MM; Methodology: MM, MD, LB; Project administration: MD; Resources: MM, NFB; Software: MM; Supervision: LB, MD; Visualization: MM, MD, LB; Writing – original draft: MM, NFB, MD; Writing – review & editing: MM, LB, MD.
Competing interests:
There are no competing interests to declare.
Data and materials availability:
Data is available on a Dryad repository.
Materials and Methods
Construction of fliC and cheR1 fliC strains
In order to visualize flagella in P. aeruginosa, we introduced a T394C substitution in the flagellum protein FliC. The primers were designed according to the method previously explained [53]. To generate the mutant FliC(T394C) construct, DNA fragments upstream and downstream of the fliC gene were amplified by PCR from PA14 genomic DNA using the following primer pairs FliC-up-for, T394C-up-rev, T394C-dn-for, FliC-dn-rev (sequences are listed in Table S2).
The cheR1 strains were obtained by removing the entire coding sequence of the cheR1 gene. DNA fragments upstream and downstream of the cheR1 gene were PCR amplified from PA14 genomic DNA using the primer pairs CheR1-up-for, CheR1-up-rev, CheR1-dn-for, CheR1-dn-rev (sequences are listed in Table S2).
PCR products for the construction of both fliC and cheR1 strains were then cloned into pMQ30 via in vitro homologous recombination using NEBuilder HiFi DNA Assembly kits (New England Biolabs). The resulting pMQ30-FliCT394C and pMQ30-UpDw-cheR1 plasmids were used to transform E. coli TG1 via electroporation. Plasmids were extracted and used to transform E. coli S17 via heat shock before being subsequently introduced into P. aeruginosa via conjugation. Integrants were selected on a Vogel-Bonner Minimal Medium (VBMM) agar, which contains (per liter): 2 g Magnesium Sulfate Heptahydrate (MgSO4-7H2O), 20 g Citric Acid (C6HO8O7), 35 g Sodium Ammonium Hydrogen Phosphate Tetrahydrate (NaNH4HPO4-4H2O), 100 g Dipotassium Phosphate (K2HPO4). After sterilization by autoclaving, the medium was supplemented with 50 g/mL gentamicin, 0.1% Casamino Acids and 1 mM MgSO4. To evict the plasmid, cells were grown in 5 mL lysogeny broth (LB) for 12-16 hours at 30∘C, serially diluted with LB, spread on LB agar containing 7% sucrose, and then incubated at 30∘C overnight. Individual colonies were patched on LB plates and LB plates containing gentamicin 50 g/mL to identify gentamicin-sensitive colonies that had evicted the plasmid. Colonies that had excised the plasmid were screened by PCR using the primer pairs T394C-check-for and FliC-check-rev, or the primer pairs CheR1-check-for and CheR1-check-rev for analyzing the fliC or cheR1 strains respectively. PCR products were sequenced using the primer T394C-check-for or cheR1-check-for to determine which isolates had retained either the allele encoding fliC or the cheR1 gene, respectively.
Bacterial colonies
Bacterial cells were grown overnight in LB medium at 37∘C with aeration. Agar plates of swarming medium (47 mM Na2HPO4, 22 mM KH2PO4, 8.5 mM NaCl, 1 mM MgSO4, 0.1 mM CaCl2, 5 g/L casamino acids (Bacto, BD)) were prepared via addition of agar to reach a 0.5% mass fraction [54]. Overnight bacterial suspension was washed twice in phosphate-buffered saline buffer (PBS) and diluted 1000-fold. 2 L of the washed suspension were used to inoculate an agar plate, which was then flipped and placed inside a 37∘C microbiological incubator overnight.
Bacterial monolayers
Monolayers were naturally present at the edge of the swarming colonies, but they were only a few dozens of cells wide and they were intrinsically anisotropic: edge cells were nearly immotile and inner cells exchanged with the bulk (Fig. 1(A)). To obtain extended, isotropic monolayers, a L water droplet was added in situ at the edge of the colony branch to disperse cells. As the water is absorbed into the gel, cells get immobilized on the gel surface (Fig. 1(B)). Cells from the bulk of the colony then migrated to the newly colonized zone, progressively increasing the surface fraction over a period of minutes.
Imaging
Swarming plates were placed inside an stage-top incubator (Okolab), regulated at 37∘C and mounted on an inverted microscope (IX-81, Olympus). Phase contrast videos of 10 seconds at 100 frames per seconds at 40 magnification were acquired using a Blackfly S camera (FLIR), with a resolution of 0.088 m/pixel. The field-of-view was cropped from to pixels to reach a frame rate of 100 frames-per-second.
Image analysis
Cell segmentation and tracking were performed using Distnet2D, a method described in [35]. The deep-learning model was trained on several high-density movies and on one low-density movie. Data analysis was performed with MATLAB (The MathWorks, Inc.).
Flagella labeling and imaging
To obtain movies of rotating flagella of P. aeruginosa in swarming state, we used the fliC mutants detailed in Table S1. 5 L of Alexa-568 maleimide (200M) was added in situ in a swarming plate assay to stain the flagella. To obtain better imaging contrast, the stained cells were then scraped out of the gel using a 1 L loop and resuspended in a PBS buffer with 1% mass fraction of Triton to avoid clumping in the suspension. A droplet of this suspension was then added to the tip of another branch of the swarming colony, following the protocol discussed above to obtain bacterial monolayers.
Data analysis
Removal of edge cells
The segmentation and tracking algorithm is able to remarkably well detect cells at the edge of the image. Nevertheless, these edge cells are incomplete, which can make the detection of their center-of-mass hazardous and amplify small displacements, or even create some non-existent displacements. We thus decided to exclude the edge cells in all our analysis (see fig. S3).
Removal of background motion
As the colonies were grown on soft agar, the imaging system is very sensitive to vibrations despite the use of an optical table. This results in visible vibrations of the gel on obtained movies (see supplementary movies). To account for this, we computed the average motion of all cells from one frame to another. We then subtracted this average motion from the displacement matrix of all cells and performed all computations using these corrected displacements.
MSD and as a function of surface fraction
To check to relevance of our fits on the MSD() and () curves, we performed data ablation experiment: on each curve, 20% of the data points were randomly removed, and a fit of the function was performed. This operation was repeated 1000 times, allowing to extract the mean and the standard deviation for each fitting parameter. The dashed lines on Fig. 2(C) and (E) were plotted using the mean of each fitting parameter. The curve envelopes were plotted using the mean of fitting parameters standard deviation.
Diffusion coefficient computation
To determine the infinite-time diffusion coefficient of the cells, we plotted and observed whether it converged. If it did, then a diffusion coefficient was extracted as the limit of this function.
We encountered an experimental limitation due to the restricted field of view. Even though our segmentation and tracking methods performed with virtually perfect accuracy, trajectories were interrupted when cells exited the field of view. Consequently, we observed a wide distribution of trajectory lengths (fig. S12(A)), with fast-moving cells more likely to escape as represented in fig. S12(B): short trajectories corresponded to fast cells. Thus, as time delay increased, the statistical weight of longer trajectories, ie slower cells, increased. The MSD at a low surface fraction ( = 0.497) cheR1 movie, computed on all trajectories, on complete (10s long) trajectories only, on trajectories shorter than 9s (excluding longer trajectories) and on trajectories shorter than 5s are presented in fig. S12(C). At short times, the MSD on all trajectories coincided with the ones computed on short trajectories, as the MSD was dominated by the fast cells. As time increased, fast cells left the field of view and the weight of slower cells increased: the MSD computed on all trajectories caught up with the MSD computed on complete trajectories only. As the MSD, the diffusion coefficient was also dominated by fast cells, therefore for an accurate computation of the diffusion coefficient, it was necessary to look at the shorter trajectories (ie faster cells). However, for a system approaching the glass transition, the diffusive regime was not always reached within the considered cutoff time. Thus, the shortest possible cutoff time for which the curve converged was chosen (in practice, one of the three mentioned sub-populations was selected). In the example of fig. S12(C), we selected the trajectories shorter than 5 s to calculate the diffusion coefficient.
Computation of for translation
is equivalent to the volume integral of the . However, the correlation on the local overlap can get very noisy after a few m (not shown in Fig. 4(C)). Computing on the whole field of view can thus lead to a very noisy measurement. To account for this, while still preserving the high statistics of our measurements, we chose to cut the long distance computation of the : for each , the field of view (originally m) was divided into 25 sub-windows of m. was independently computed considering all cells initially present in each sub-window, and then averaged over all sub-windows. This allowed all short and medium distance pairs to be considered, while ignoring the long distance pairs, whose signal-to-noise ratio was insufficient.
Computation of and for rotation
We performed rotation calculations in a manner similar to those for translation. We first calculate the four-point dynamic susceptibility with where the local overlap (with ) is a convenient local indicator of rotation. To accurately measure the linear size of correlated domains, we calculated the spatial correlations between fluctuations of the local overlaps, , with , see Fig. 4(C). The measured four-point spatial correlation functions decay exponentially with distance, , which provides a determination of a characteristic correlation length .
Supplementary Text
Fisher’s exact test for position and orientation coupling
We defined a cell as having relaxed its initial orientation when it turned by an angle of 45∘ or more. Similarly, we defined a as having relaxed its initial position when its center of mass moved a distance greater than the average cell body length. To assess whether orientation relaxation and position relaxation are coupled, we studied the binary state (Position relaxed; Orientation relaxed) by constructing a contingency table. We performed a Fisher’s exact test on this table for the three movies presented in Fig. 4(A). The p-values obtained were , , and for the three movies, indicating a strong coupling between the two relaxation modes: cells tended to turn their bodies while moving and vice versa. This result was visually supported by relaxation maps shown in fig. S9: most of the cells either relaxed both their orientation and position or neither. Few cells relaxed their position only or their relaxation only.
Name Flagellum Type IV pili Aspect ratio Flagellar motion Origin and Reference Wild type One Yes 3.89 0.97 Forward-backward Pseudomonas aeruginosa PA14 Hyperswarmer Multiple Yes 3.54 0.93 Forward-backward Point mutation FleN(V178G), described in [55] (Clone 4 of [56]) Hyperswarmer frik Multiple Yes 5.62 1.84 Forward-backward Point mutation FleN(W253C), and a 9-bp deletion in PA14_65570, described in [21] (Clone 5 of [56]) pilA One No 3.90 1.00 Forward-backward Clean deletion of gene pilA, [57], generous gift of Dominique Limoli cheR1 One Yes 3.26 0.81 Only forward cheR1 transposon mutant from the NR PA14 transposon mutant library [58], described in [59], generous gift of Susanne Häußler Wild type fliC One Yes 3.55 0.92 Forward-backward Point mutation FliC(T394C) that allows for Alexa-maleimide labeling of the flagellum, described in [53]. This study.
Name Sequence FliC-up-for tgtaaaacgacggccagtgccaagcttgcatgcctgCGACCTCAACACCTCGTTGCA T394C-up-rev GTTCTGGGCGCCGTCGGCGCAGGAGATGTCGACGCTGGCAACGCT T394C-dn-for AGCGTTGCCAGCGTCGACATCTCCTGCGCCGACGGCGCCCAGAAC FliC-dn-rev ggaaacagctatgaccatgattacgaattcgagctcCGCGCTGATCGCACTCTTGA CheR1-up-for gcctgcaggtcgactctagaggatcGAAGAGATCCATCCGCCACC CheR1-up-rev GCATAAGCCTCTTCGCCCTG CheR1-dn-for gtcgcccagggcgaagaggcttatgcCGCAAGGAAGCGGACCCG CheR1-dn-rev gtcgcccagggcgaagaggcttatgcCGCAAGGAAGCGGACCCG T394C-check-for cgacaagggtgtactgaccatca FliC-check-rev gcgctcgccttgagaatgtct CheR1-check-for GATGGTGAAGAAGGTCGGTG CheR1-check-rev CTGTCAATACAACTAGATCGCG